ID: 1075293766

View in Genome Browser
Species Human (GRCh38)
Location 10:121254166-121254188
Sequence TGAGGTCACCAGTTGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075293766_1075293770 11 Left 1075293766 10:121254166-121254188 CCTTCCAGCAACTGGTGACCTCA No data
Right 1075293770 10:121254200-121254222 TCAGCATTTCCAGATACCAAGGG No data
1075293766_1075293771 12 Left 1075293766 10:121254166-121254188 CCTTCCAGCAACTGGTGACCTCA No data
Right 1075293771 10:121254201-121254223 CAGCATTTCCAGATACCAAGGGG No data
1075293766_1075293769 10 Left 1075293766 10:121254166-121254188 CCTTCCAGCAACTGGTGACCTCA No data
Right 1075293769 10:121254199-121254221 GTCAGCATTTCCAGATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075293766 Original CRISPR TGAGGTCACCAGTTGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr