ID: 1075293766 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:121254166-121254188 |
| Sequence | TGAGGTCACCAGTTGCTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1075293766_1075293770 | 11 | Left | 1075293766 | 10:121254166-121254188 | CCTTCCAGCAACTGGTGACCTCA | No data | ||
| Right | 1075293770 | 10:121254200-121254222 | TCAGCATTTCCAGATACCAAGGG | No data | ||||
| 1075293766_1075293771 | 12 | Left | 1075293766 | 10:121254166-121254188 | CCTTCCAGCAACTGGTGACCTCA | No data | ||
| Right | 1075293771 | 10:121254201-121254223 | CAGCATTTCCAGATACCAAGGGG | No data | ||||
| 1075293766_1075293769 | 10 | Left | 1075293766 | 10:121254166-121254188 | CCTTCCAGCAACTGGTGACCTCA | No data | ||
| Right | 1075293769 | 10:121254199-121254221 | GTCAGCATTTCCAGATACCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1075293766 | Original CRISPR | TGAGGTCACCAGTTGCTGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||