ID: 1075295348

View in Genome Browser
Species Human (GRCh38)
Location 10:121270396-121270418
Sequence TATCAATCCAGTATCTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075295343_1075295348 26 Left 1075295343 10:121270347-121270369 CCAAAAATACTGAGGGGATAGAC No data
Right 1075295348 10:121270396-121270418 TATCAATCCAGTATCTATCTGGG No data
1075295342_1075295348 27 Left 1075295342 10:121270346-121270368 CCCAAAAATACTGAGGGGATAGA No data
Right 1075295348 10:121270396-121270418 TATCAATCCAGTATCTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075295348 Original CRISPR TATCAATCCAGTATCTATCT GGG Intergenic
No off target data available for this crispr