ID: 1075305886

View in Genome Browser
Species Human (GRCh38)
Location 10:121366706-121366728
Sequence GTTTAAGAGTCAATCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075305882_1075305886 28 Left 1075305882 10:121366655-121366677 CCATTTTTACATGTTCAGATTGT No data
Right 1075305886 10:121366706-121366728 GTTTAAGAGTCAATCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075305886 Original CRISPR GTTTAAGAGTCAATCTGACC TGG Intergenic
No off target data available for this crispr