ID: 1075309832

View in Genome Browser
Species Human (GRCh38)
Location 10:121404934-121404956
Sequence CAGCCCTCCTGGAGGACAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075309826_1075309832 28 Left 1075309826 10:121404883-121404905 CCCTCTTCTCTTAAAGATGGTAC No data
Right 1075309832 10:121404934-121404956 CAGCCCTCCTGGAGGACAAACGG No data
1075309827_1075309832 27 Left 1075309827 10:121404884-121404906 CCTCTTCTCTTAAAGATGGTACA No data
Right 1075309832 10:121404934-121404956 CAGCCCTCCTGGAGGACAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075309832 Original CRISPR CAGCCCTCCTGGAGGACAAA CGG Intergenic
No off target data available for this crispr