ID: 1075314162

View in Genome Browser
Species Human (GRCh38)
Location 10:121438748-121438770
Sequence GGCCTTAGGGGACCAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075314162_1075314169 5 Left 1075314162 10:121438748-121438770 CCAGCTTTTGGTCCCCTAAGGCC No data
Right 1075314169 10:121438776-121438798 ATCTGCTCTGTAGCTGAGGTAGG No data
1075314162_1075314171 12 Left 1075314162 10:121438748-121438770 CCAGCTTTTGGTCCCCTAAGGCC No data
Right 1075314171 10:121438783-121438805 CTGTAGCTGAGGTAGGTGATGGG No data
1075314162_1075314168 1 Left 1075314162 10:121438748-121438770 CCAGCTTTTGGTCCCCTAAGGCC No data
Right 1075314168 10:121438772-121438794 TCGGATCTGCTCTGTAGCTGAGG No data
1075314162_1075314170 11 Left 1075314162 10:121438748-121438770 CCAGCTTTTGGTCCCCTAAGGCC No data
Right 1075314170 10:121438782-121438804 TCTGTAGCTGAGGTAGGTGATGG No data
1075314162_1075314172 13 Left 1075314162 10:121438748-121438770 CCAGCTTTTGGTCCCCTAAGGCC No data
Right 1075314172 10:121438784-121438806 TGTAGCTGAGGTAGGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075314162 Original CRISPR GGCCTTAGGGGACCAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr