ID: 1075316144

View in Genome Browser
Species Human (GRCh38)
Location 10:121455171-121455193
Sequence TCTCCTTCCTGGTGGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075316136_1075316144 27 Left 1075316136 10:121455121-121455143 CCTTCTTCTCATTTAATGGGGAA No data
Right 1075316144 10:121455171-121455193 TCTCCTTCCTGGTGGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075316144 Original CRISPR TCTCCTTCCTGGTGGCCTTG TGG Intergenic
No off target data available for this crispr