ID: 1075317839

View in Genome Browser
Species Human (GRCh38)
Location 10:121466572-121466594
Sequence TGTTAGGCAGAGAAACTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075317839_1075317850 8 Left 1075317839 10:121466572-121466594 CCCCCCAGTTTCTCTGCCTAACA No data
Right 1075317850 10:121466603-121466625 CTAAAATCTTTTTCCTCCTCAGG No data
1075317839_1075317852 20 Left 1075317839 10:121466572-121466594 CCCCCCAGTTTCTCTGCCTAACA No data
Right 1075317852 10:121466615-121466637 TCCTCCTCAGGAAGCCACAAGGG No data
1075317839_1075317851 19 Left 1075317839 10:121466572-121466594 CCCCCCAGTTTCTCTGCCTAACA No data
Right 1075317851 10:121466614-121466636 TTCCTCCTCAGGAAGCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075317839 Original CRISPR TGTTAGGCAGAGAAACTGGG GGG (reversed) Intergenic
No off target data available for this crispr