ID: 1075322044

View in Genome Browser
Species Human (GRCh38)
Location 10:121499295-121499317
Sequence CTGAATTAGCTTGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075322044_1075322050 -7 Left 1075322044 10:121499295-121499317 CCCTCCACCTCAAGCTAATTCAG 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1075322050 10:121499311-121499333 AATTCAGTATGGAAAAATCTGGG No data
1075322044_1075322054 27 Left 1075322044 10:121499295-121499317 CCCTCCACCTCAAGCTAATTCAG 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1075322054 10:121499345-121499367 AAAAAAATGAAATATGGGCATGG No data
1075322044_1075322052 21 Left 1075322044 10:121499295-121499317 CCCTCCACCTCAAGCTAATTCAG 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1075322052 10:121499339-121499361 TTTAAAAAAAAAATGAAATATGG No data
1075322044_1075322049 -8 Left 1075322044 10:121499295-121499317 CCCTCCACCTCAAGCTAATTCAG 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1075322049 10:121499310-121499332 TAATTCAGTATGGAAAAATCTGG No data
1075322044_1075322053 22 Left 1075322044 10:121499295-121499317 CCCTCCACCTCAAGCTAATTCAG 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1075322053 10:121499340-121499362 TTAAAAAAAAAATGAAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075322044 Original CRISPR CTGAATTAGCTTGAGGTGGA GGG (reversed) Intronic
902302903 1:15515284-15515306 CTGCATTTGCTTGAAGTGTAAGG - Intronic
904045576 1:27606324-27606346 CTGAAGTAGCCTGGGGTGGGAGG - Intergenic
908471529 1:64448741-64448763 CTGAAATAGCTGGAGGAGAAGGG + Intergenic
913986622 1:143571444-143571466 CTGAATGAGCTTTTGGTAGAGGG + Intergenic
914205023 1:145519231-145519253 CTGAATGAGCTTTTGGTAGAGGG + Intergenic
914370551 1:147020997-147021019 CTGAATGAGCTTTTGGTAGAGGG - Intergenic
914484144 1:148092413-148092435 CTGAATGAGCTTTTGGTAGAGGG + Intergenic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
916061911 1:161104898-161104920 CTAAAGTAGCTTGAGATGAAGGG - Intronic
917956511 1:180104793-180104815 CTGAAATAGCTTTAAGTGCAAGG - Intronic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
924166247 1:241286429-241286451 CTGAACTAGGTTTAGATGGAAGG - Intronic
1065890291 10:30115583-30115605 CTTGATTCACTTGAGGTGGATGG - Intergenic
1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG + Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1071717134 10:88108304-88108326 CTGAATTAGCTGTTGGGGGAGGG + Intergenic
1072304938 10:94098014-94098036 CTGAAGTAGCCTGATTTGGAAGG + Intronic
1073563497 10:104516578-104516600 CTGGGTTAGCTTGAAGTGGGGGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1078290525 11:10006160-10006182 CTGACTTGCCTCGAGGTGGACGG - Intronic
1081102995 11:39028550-39028572 CTGAAATAGAATGAGGTGTATGG + Intergenic
1086347805 11:85915151-85915173 CTGAGTCAGCTTTAGGGGGAAGG - Intronic
1087809069 11:102590623-102590645 CTGAACTAGCATGAGGAGCAAGG + Intronic
1091841230 12:3622443-3622465 CTGAAATAACTGAAGGTGGAGGG - Intronic
1092286580 12:7132145-7132167 CTGAATTGGCTGGTGGTTGAAGG + Intronic
1093779046 12:23112844-23112866 CTTACTAAGCTTGAGGTGAAGGG + Intergenic
1096571111 12:52523869-52523891 CTGAACAAGCGTGAGGTGGAAGG - Intergenic
1098808272 12:75049945-75049967 GTGAATTAGGTTGAGATGCATGG + Intronic
1100421208 12:94435677-94435699 CTGAAATGGCTTGAGTTGGTTGG - Intronic
1104393409 12:128410297-128410319 CTCAAACAGCTTGGGGTGGAGGG - Intronic
1105314244 13:19242773-19242795 CTGTAATAGCTTGAGTTGGTTGG - Intergenic
1106314416 13:28580459-28580481 ATGAATTGGTTTGGGGTGGAAGG + Intergenic
1106380749 13:29236506-29236528 TTGAAATAGCTTGTGGTGAAAGG + Intronic
1110371552 13:74746778-74746800 CTCTCTTAGCTTAAGGTGGATGG - Intergenic
1113874609 13:113586151-113586173 CTTAATTAAATTGAGGTGGAGGG + Intronic
1120462342 14:84813248-84813270 CTAATTTAGCTTGGGTTGGAAGG - Intergenic
1128052230 15:64674583-64674605 CTGAATTTGCTTGAAGGAGAAGG - Exonic
1130335754 15:82955892-82955914 CTAATTTAGGTTGAGGAGGATGG + Intronic
1130967903 15:88710669-88710691 CTAAATTGGCTTGGGGAGGAGGG + Intergenic
1131501326 15:92969723-92969745 ATGAATTAGCTTGGTGTGGTTGG - Intronic
1132300552 15:100772971-100772993 TTCAATTAGCTTGAGAGGGAAGG - Intergenic
1140742133 16:77951083-77951105 CTGTATTTCCTTCAGGTGGATGG - Intronic
1143243358 17:5462764-5462786 ATTAAATAGCTTGAGGTAGAAGG - Intronic
1146008905 17:29179269-29179291 CAGAATGAGCTAGAGGTGGGGGG - Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG + Intronic
1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG + Intronic
1150455369 17:65303007-65303029 GTGAATGAGCTTGAGGTTTAGGG + Intergenic
1159698434 18:71591282-71591304 TTGAAGATGCTTGAGGTGGAAGG + Intergenic
1165182902 19:33987976-33987998 GTGAATTAGCTGGAGAGGGAAGG + Intergenic
1167874192 19:52398008-52398030 CTGAATTTACTCGGGGTGGAGGG - Intronic
1168724297 19:58572373-58572395 CTGATTTAGCTGGGGTTGGAAGG + Intronic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
925956140 2:8967042-8967064 CTGAATTGACTTGAGATGTATGG - Intronic
926103012 2:10132632-10132654 CTGAAGTATTTTGGGGTGGATGG + Intergenic
928472966 2:31592237-31592259 CTGTAATGGCTTGAGTTGGATGG - Intergenic
930843528 2:55875617-55875639 ATGAATTGGCTTGTGGTTGACGG + Intronic
932152774 2:69387687-69387709 AAGAATTAGGTTGAGGTGGGAGG + Intergenic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
935934918 2:108171228-108171250 TTGAATGTGCTTGAGGAGGAAGG - Intergenic
938706014 2:133927724-133927746 CTTAGTTAGCTTGAGTTGAAAGG + Intergenic
942730865 2:179059183-179059205 CTAAATAAGCTAGATGTGGATGG - Intergenic
947344986 2:229181131-229181153 CAGAATTAGCTGGAGGGTGAAGG - Intronic
948188255 2:236038371-236038393 CTGAATTAGGTCGAGGTGGCAGG - Intronic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1172062062 20:32193440-32193462 CTGCATCATCTTGAGGTGGGAGG - Exonic
1172706759 20:36887683-36887705 CTGGCTTAGCGTGAGGTTGAGGG - Intronic
1173545396 20:43893919-43893941 GTGAATTTGCTTTACGTGGAAGG - Intergenic
1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG + Intergenic
1176285820 21:5018967-5018989 CGGGATTAAATTGAGGTGGAAGG + Intergenic
1178632135 21:34271082-34271104 CACAATTATCTTGAGGTGCAAGG - Intergenic
1179871361 21:44244508-44244530 CGGGATTAAATTGAGGTGGAAGG - Intergenic
1182051018 22:27313005-27313027 CTGAATTAGGTTCAGGGGTAGGG - Intergenic
950602376 3:14045970-14045992 CTGCATTTGCTTGAGGGGGAGGG + Intronic
951151343 3:19293611-19293633 ATGAATTAGCTTAATCTGGATGG - Intronic
951410098 3:22353121-22353143 AGAAATTTGCTTGAGGTGGAAGG - Intronic
953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG + Intergenic
960065035 3:113362385-113362407 CTGCAGCAGCTTGATGTGGAGGG + Intronic
960719330 3:120610432-120610454 CTGAATTTCCTGGAGCTGGATGG + Intergenic
963859794 3:150297374-150297396 TTGAGTTGGCTGGAGGTGGAAGG + Intergenic
964381660 3:156103812-156103834 TTGAATTAGCTCCAGGTGAAAGG + Intronic
965015590 3:163153244-163153266 CTGTAATAGCTTGAGTTGGTTGG + Intergenic
966626548 3:182022974-182022996 CTGAATTTGTTTGAGCTGTATGG - Intergenic
966700206 3:182841027-182841049 CAGGATGAGCTAGAGGTGGAAGG - Intronic
970390949 4:15613253-15613275 TTGAATTAGTCTGTGGTGGATGG + Intronic
972109350 4:35537348-35537370 CTGAATTAAAGTGAGGAGGAAGG - Intergenic
974310399 4:60200902-60200924 CTGAATCAGAATGAAGTGGAGGG - Intergenic
976367569 4:84247222-84247244 CTGCATCATCTTGAGGTGGGAGG + Intergenic
978236183 4:106463737-106463759 CTGAATTCACTTGAGGAGCAAGG + Intergenic
978860000 4:113437530-113437552 CTGATTTTGCTTGGGTTGGATGG + Intergenic
978963301 4:114710352-114710374 GTGGATTAGCTTTAGCTGGATGG - Intergenic
980459316 4:133085484-133085506 TTGAACTAGCATGAGGTGGTAGG + Intergenic
981976312 4:150733353-150733375 CTGAAGTATTTTGAGGTAGAAGG + Intronic
983037462 4:162885423-162885445 CTGAATTAGCTCTTGGGGGAAGG - Intergenic
983555575 4:169056335-169056357 CTGAATTATGTTGAGCAGGATGG + Intergenic
984471760 4:180184490-180184512 CTGAATTTGGTTGTGGTGGTGGG + Intergenic
985725692 5:1514803-1514825 CTGTTTTGGCTGGAGGTGGAAGG - Intronic
990631518 5:57675530-57675552 CTGAAATTGCTAGAAGTGGAGGG - Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
994722089 5:103392135-103392157 CTGATTTATCCTGAGGTGGTGGG + Intergenic
996147442 5:119993140-119993162 GGGACTTAGCATGAGGTGGAAGG + Intergenic
998200907 5:140119482-140119504 CTGAATTAAATTTGGGTGGAAGG + Exonic
999450999 5:151678089-151678111 CTGAGATAGTTTGAGGTTGAAGG + Intronic
999513858 5:152280761-152280783 TTCCATTAGCTTGAGGTGTAGGG + Intergenic
1000826904 5:166056109-166056131 CCAAAATAGCTTGAGGTTGATGG - Intergenic
1007029413 6:38614658-38614680 ATGGATTAGGTTGAGGTCGAAGG - Intronic
1014802847 6:125796338-125796360 CTGATTTATATTGAGGTGGGTGG - Intronic
1015025340 6:128525618-128525640 GTGAATTGGATTGAGGTGGAGGG + Intergenic
1020205201 7:6109163-6109185 GTGAACTGGCTGGAGGTGGAAGG + Intronic
1021112529 7:16711915-16711937 CTGAATCAGCATGAGCTGGGAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1031627216 7:124004961-124004983 CTGAGTTAACCTGGGGTGGAAGG - Intergenic
1033816680 7:145082537-145082559 CTGTAATAGCTTGAGTTGGTTGG + Intergenic
1039677384 8:39684588-39684610 CTCAATCAGCCTGAGGTTGAGGG + Intronic
1039843798 8:41311454-41311476 CGCATTTGGCTTGAGGTGGAGGG - Intergenic
1045551510 8:103176935-103176957 CTGAGTTAGTTTGAGCTGGTGGG + Intronic
1045557832 8:103231885-103231907 CTGCATTAGCTGGAGCTGGGAGG + Intergenic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1049965867 9:779155-779177 CTGAAATAGTTTGAGGAGAATGG - Intergenic
1051035218 9:12736517-12736539 CTGCATTAGCCTTAGGTAGATGG + Intergenic
1053161506 9:35816639-35816661 TTGAATTAGTTTTAGGTGAATGG + Intronic
1056386542 9:86101563-86101585 CTGCATCAGCCTGTGGTGGAAGG + Intergenic
1056923056 9:90809016-90809038 GTGCATATGCTTGAGGTGGAAGG + Intronic
1059776900 9:117485108-117485130 CTACATTAGCATGGGGTGGATGG - Intergenic
1186254646 X:7705153-7705175 ATCATTTAGCTTAAGGTGGATGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1188816566 X:34722245-34722267 CAGAATGAGCTTGATGGGGAAGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1195502124 X:105613636-105613658 TTTAATGAGCTTGTGGTGGATGG - Intronic
1197544324 X:127806259-127806281 CTGAATTGGATTAAGTTGGAGGG - Intergenic
1202026807 Y:20532781-20532803 CATTATTAGCTTGATGTGGATGG - Intergenic