ID: 1075322050

View in Genome Browser
Species Human (GRCh38)
Location 10:121499311-121499333
Sequence AATTCAGTATGGAAAAATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075322043_1075322050 0 Left 1075322043 10:121499288-121499310 CCATGTGCCCTCCACCTCAAGCT 0: 1
1: 0
2: 2
3: 17
4: 299
Right 1075322050 10:121499311-121499333 AATTCAGTATGGAAAAATCTGGG No data
1075322041_1075322050 19 Left 1075322041 10:121499269-121499291 CCTAAGTGGCAAGACTTTCCCAT 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1075322050 10:121499311-121499333 AATTCAGTATGGAAAAATCTGGG No data
1075322044_1075322050 -7 Left 1075322044 10:121499295-121499317 CCCTCCACCTCAAGCTAATTCAG 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1075322050 10:121499311-121499333 AATTCAGTATGGAAAAATCTGGG No data
1075322042_1075322050 1 Left 1075322042 10:121499287-121499309 CCCATGTGCCCTCCACCTCAAGC 0: 1
1: 1
2: 0
3: 20
4: 188
Right 1075322050 10:121499311-121499333 AATTCAGTATGGAAAAATCTGGG No data
1075322045_1075322050 -8 Left 1075322045 10:121499296-121499318 CCTCCACCTCAAGCTAATTCAGT 0: 1
1: 0
2: 0
3: 24
4: 960
Right 1075322050 10:121499311-121499333 AATTCAGTATGGAAAAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075322050 Original CRISPR AATTCAGTATGGAAAAATCT GGG Intronic
No off target data available for this crispr