ID: 1075322570

View in Genome Browser
Species Human (GRCh38)
Location 10:121503896-121503918
Sequence CATGAACTCCAACACCCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075322570_1075322574 4 Left 1075322570 10:121503896-121503918 CCAGCGGGGTGTTGGAGTTCATG 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1075322574 10:121503923-121503945 AGCTGGACTCAGCCGAAACCTGG 0: 1
1: 0
2: 0
3: 11
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075322570 Original CRISPR CATGAACTCCAACACCCCGC TGG (reversed) Exonic
903128567 1:21263720-21263742 CATGAACACCAACTCCTGGCGGG - Intronic
904711098 1:32430913-32430935 CATGAACCACCACACCCGGCTGG + Intergenic
905277426 1:36827531-36827553 CATGAACTCCAACAGACACCAGG + Intronic
907084124 1:51653715-51653737 CGTGAGCTCCAGCACCCAGCCGG - Intronic
916097875 1:161367054-161367076 CGTGAGCTACAACACCCAGCAGG + Exonic
916492574 1:165314938-165314960 CCTGAACACCAACACCCCAGAGG + Intronic
917904783 1:179577708-179577730 CATGGGCTCCAACACCCAGTAGG - Intergenic
918757625 1:188357610-188357632 CATGCAATCCAAAACCCAGCAGG + Intergenic
920230022 1:204464017-204464039 CAGGAACTCCTCCAGCCCGCAGG + Exonic
922690203 1:227683031-227683053 CCTGAAGTCCAGCACCCTGCAGG + Intergenic
922874369 1:228928321-228928343 CATGAACTGCAAAGCCCCGCAGG - Intergenic
1066750285 10:38648949-38648971 CATGAGCTACCACACCTCGCTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067306521 10:45069744-45069766 CCTGAAGTTCAACACCCTGCGGG + Intergenic
1067675028 10:48366727-48366749 AATGAGCTCCAACACACCGATGG - Intronic
1071019152 10:81031364-81031386 CAGGGACTTCAACACCCCACTGG + Intergenic
1075322570 10:121503896-121503918 CATGAACTCCAACACCCCGCTGG - Exonic
1077825618 11:5805651-5805673 CCTGAAGTCCAACACCCTGGAGG - Intronic
1086056647 11:82654495-82654517 CATGAAGTCCAAAACCCAGTGGG - Intergenic
1088248399 11:107841279-107841301 CATGAGCTGCCACACCCGGCCGG - Intronic
1090818097 11:130315773-130315795 CAAGAACTTCAAAACCCCCCGGG - Intergenic
1092020683 12:5200008-5200030 CATGACCTCCCACACCCAGCAGG + Intergenic
1092630481 12:10371006-10371028 CCTGAAATTCAACACCCTGCGGG + Intergenic
1096404808 12:51335916-51335938 CATGAGCTACTACACCCGGCTGG + Intronic
1100941112 12:99723446-99723468 CAGGAACTCCAACTCCAGGCAGG + Intronic
1101785870 12:107883127-107883149 CAAGCCCTCCAACACCCCTCTGG + Intergenic
1105410071 13:20164265-20164287 CATGAGCTACCACACCCAGCTGG - Intergenic
1106428048 13:29652038-29652060 CATGAACCACCACACCCAGCTGG + Intergenic
1106726958 13:32495962-32495984 CATGAACCACCCCACCCCGCCGG + Intronic
1107671887 13:42754394-42754416 CATGATCTCCTACACTCCTCAGG - Intergenic
1114734670 14:25032160-25032182 CATGGTCTCCAACACCGCGAAGG + Intronic
1119658299 14:76432954-76432976 CATGAGCTACCACACCCGGCTGG + Intronic
1121975455 14:98399314-98399336 CATGAACCACCACACCCGGCTGG + Intergenic
1122087352 14:99316997-99317019 CATGCACTCCACTACCCCTCTGG - Intergenic
1126378382 15:48019821-48019843 CATGAGCTACTACACCCAGCCGG - Intergenic
1130263116 15:82375107-82375129 CCTGAAGTCCAACACCCTGCAGG - Intergenic
1130278176 15:82494556-82494578 CCTAAAGTCCAACACCCTGCAGG + Intergenic
1130470505 15:84221741-84221763 CCTAAAGTCCAACACCCTGCAGG + Intergenic
1130477993 15:84336308-84336330 CCTAAAGTCCAACACCCTGCAGG + Intergenic
1130493772 15:84451822-84451844 CCTAAAGTCCAACACCCTGCAGG - Intergenic
1130592792 15:85226367-85226389 CCTAAAGTCCAACACCCTGCAGG + Intergenic
1131369572 15:91868331-91868353 CATGAACCACCACACCCAGCCGG + Intronic
1133955852 16:10443326-10443348 CCTGAAGTCCAGCACCCTGCAGG - Intronic
1134717709 16:16365151-16365173 CATGAGCTTCAGCACCTCGCTGG + Intergenic
1134957043 16:18387008-18387030 CATGAGCTTCAGCACCTCGCTGG - Intergenic
1135731025 16:24895205-24895227 CATGAGCTGCCACACCCAGCCGG - Intronic
1139377162 16:66506988-66507010 GATGAACTCCACCATACCGCAGG - Intronic
1141432961 16:83980431-83980453 CAGGAACTCCAGGACCCAGCAGG + Intronic
1141503471 16:84460358-84460380 GATGATCTCCATCACCCCGAGGG - Intronic
1143313620 17:6014254-6014276 CATAAACTCCCACCTCCCGCTGG + Intronic
1144432609 17:15208591-15208613 CAGGAACTCCTACACACTGCTGG + Intergenic
1149980570 17:61308094-61308116 CGTGAACTCCAACGCCTGGCTGG - Intronic
1151322425 17:73359921-73359943 CGTGAACCCCCACACCCGGCTGG + Intronic
1151408735 17:73906860-73906882 CATGACCTCCCACACTCCCCAGG - Intergenic
1157721618 18:49929541-49929563 AATCGTCTCCAACACCCCGCAGG + Exonic
1158781991 18:60663124-60663146 CCTGCACTCCACCACCCCCCCGG + Intergenic
1160458878 18:79022552-79022574 CATGGAATCCAACAGCCGGCTGG + Intergenic
1162703827 19:12540571-12540593 CATGAGCTACCACACCCAGCCGG - Intronic
1163929357 19:20374228-20374250 CCTGAAGTCCAACACCCTGTGGG + Intergenic
1164297665 19:23927761-23927783 CATGAGCTACACCACCCAGCTGG + Intronic
1166291112 19:41864120-41864142 CATGAGCTCCCGCACCCAGCTGG + Intronic
1167468056 19:49660626-49660648 CAGGAACTCCAACTCCCAGAGGG - Intronic
926503370 2:13681499-13681521 CCTGAAGTTCAACACCCTGCGGG + Intergenic
928877195 2:36053845-36053867 CATGAAATCCAACAACCTGAGGG + Intergenic
931493577 2:62777250-62777272 CATGAGCTACCACACCCAGCTGG + Intronic
933760067 2:85666841-85666863 CGTGAACTCCAGCACCCTGGGGG - Intronic
934544214 2:95201201-95201223 CATGACCACCACCACCCCCCTGG - Intergenic
935068003 2:99668449-99668471 CATGAGCCACCACACCCCGCCGG + Intronic
940675015 2:156717022-156717044 CATGAGCTACCACACCCAGCTGG - Intergenic
943705229 2:191027079-191027101 CATCAAGTCCAAAACCCAGCAGG - Intergenic
1168990695 20:2093803-2093825 CATAAACTACAACACTCAGCTGG - Intergenic
1170171946 20:13424532-13424554 CATGAACTCCAGCAACACGCAGG + Intronic
1170788759 20:19490713-19490735 CATGAAATCCCACATCCCTCAGG - Intronic
1174259399 20:49282830-49282852 CCTGAAGTCCGACACCCTGCGGG - Intergenic
1174489930 20:50885653-50885675 CATGAGCTACCACACCCGGCCGG + Intergenic
1175884973 20:62284658-62284680 CATGAACCACAACACCCAGCCGG + Intronic
1181109288 22:20591848-20591870 CATGAACTCCAGCACCTGCCTGG - Intergenic
1182693899 22:32183339-32183361 CATGAACCACCACACCCAGCTGG + Intergenic
1184385001 22:44169011-44169033 CCTGAACCCCAACCCCCAGCTGG + Intronic
1184813026 22:46850094-46850116 CATGCACTCCAGCACACAGCAGG - Intronic
1184879637 22:47296788-47296810 CCTGAACTCCCGCAACCCGCTGG - Intergenic
950480396 3:13240095-13240117 CATGAACCACCACACCCGGCCGG - Intergenic
955199304 3:56835753-56835775 CATAAAGTCCAACACACCCCAGG + Intronic
955249301 3:57262665-57262687 CATGAGCTGCCACACCCAGCTGG + Intronic
957919771 3:86732464-86732486 TATGAACTTCAACACCACGAAGG - Intergenic
960501826 3:118447023-118447045 CATGTGCTCCAACACCTCACAGG + Intergenic
964611947 3:158624516-158624538 CCTGAAGTCCAACACCCTGCAGG - Intergenic
968110156 3:196039132-196039154 CATGAACTACTGCACCCGGCCGG - Intronic
968178213 3:196569103-196569125 CACCAACTCCAGCACCCGGCTGG - Exonic
968662564 4:1804847-1804869 CATGAGCTCCAACACACCACTGG + Exonic
971255375 4:25009218-25009240 CATCAACTGCAACTCCCCGCTGG + Intronic
973890251 4:55361198-55361220 CATGAACCACCACACCCGGCCGG - Intronic
976608759 4:87007353-87007375 CATGAGCGCCTTCACCCCGCGGG - Intronic
978314272 4:107418360-107418382 CCCGAAGTCCAACACCCTGCGGG + Intergenic
979237107 4:118413533-118413555 AATGATCTCCAAAACCCAGCAGG - Intergenic
982910001 4:161128075-161128097 CATGAGATCCAACACCCCAGAGG - Intergenic
983593397 4:169440123-169440145 CATGAGCTACCACACCCGGCTGG + Intronic
985718945 5:1479112-1479134 CGTGAACTACCACACCCAGCTGG - Intronic
988897360 5:35692127-35692149 CATGAGCTACCACACCCAGCCGG - Intronic
990813621 5:59757077-59757099 CATGAACTACCGCACCCGGCCGG + Intronic
994596098 5:101837486-101837508 CAGGAACTTCAACACCCCACTGG - Intergenic
994857048 5:105135808-105135830 CAGGAAGTCCAACACCCGGCAGG - Intergenic
1005810796 6:29514524-29514546 CATGAAGCCCAACACCTCACTGG + Intergenic
1006784953 6:36660297-36660319 CAGGGTCTCGAACACCCCGCTGG - Intergenic
1007199587 6:40095413-40095435 CATCAACTCCCACTCCCCACTGG - Intergenic
1007550644 6:42727389-42727411 CATGAAGTCCATCATCCCGGTGG + Intergenic
1011449755 6:87480239-87480261 CCTGAAGTCCAACACCCTGCAGG - Intronic
1012365056 6:98428979-98429001 CATGAAATCCAACTCCCTGTGGG + Intergenic
1013508262 6:110820516-110820538 CATGAGCTACCACACCCGGCTGG + Intronic
1014111239 6:117620358-117620380 CCTGAAATTCAACACCCTGCAGG + Intergenic
1014276247 6:119393828-119393850 CATGCACTCCAACTCCCACCTGG - Intergenic
1014308008 6:119766339-119766361 CCTGAAGTTCAACACCCTGCAGG - Intergenic
1017684135 6:156895019-156895041 CATGAACACCACCACACCACTGG - Intronic
1018137622 6:160792853-160792875 CCTGAAATTCAACACCCTGCGGG + Intergenic
1021737982 7:23657734-23657756 CCTGAAGTTCAACACCCTGCAGG + Intergenic
1022862066 7:34377461-34377483 CATGAAGTCCAAAACCCAGCAGG - Intergenic
1026548458 7:71345899-71345921 CATGAGCCCCCACACCCAGCTGG - Intronic
1029306770 7:99625414-99625436 CCTGAACTCTAAGACCCCACAGG - Intronic
1038739358 8:30203296-30203318 CATGAACCACCACACCCAGCAGG - Intergenic
1040278619 8:46026403-46026425 CATGGACTCCACGACCCCTCCGG + Intergenic
1040543758 8:48381038-48381060 CATGATCTCCATCACCCGGCGGG - Intergenic
1040672816 8:49712953-49712975 CATGCACTCCCAACCCCCGCAGG - Intergenic
1042646005 8:70987443-70987465 CATGAAGTCCAAAATCCAGCAGG + Intergenic
1044237568 8:89849254-89849276 CATGAATTTCAACACCTCTCAGG - Intergenic
1048081139 8:131128564-131128586 CATGATGTCCAACACACAGCAGG + Intergenic
1052508137 9:29381200-29381222 CACGAAGTCCAGCACCCTGCGGG + Intergenic
1053665389 9:40313999-40314021 CATGAAGTCAAAAACCCAGCAGG - Intronic
1053914977 9:42939046-42939068 CATGAAGTCAAAAACCCAGCAGG - Intergenic
1054376540 9:64454029-64454051 CATGAAGTCAAAAACCCAGCAGG - Intergenic
1054519226 9:66062285-66062307 CATGAAGTCAAAAACCCAGCAGG + Intergenic
1054858566 9:69926858-69926880 CCTGAAATCCAACACCCTGCGGG - Intergenic
1056599938 9:88038957-88038979 CCTGAAGTTCAACACCCTGCGGG - Intergenic
1058048718 9:100384932-100384954 CATGAAATCCAAGAACCCTCTGG + Intergenic
1058966733 9:110045847-110045869 CATGAGCTACCACACCCTGCCGG + Intronic
1062547496 9:137070245-137070267 CAAGCCCTCCAGCACCCCGCGGG + Exonic
1187473598 X:19590290-19590312 CAGGAACTCCAGCAGCCTGCTGG + Intronic
1189775818 X:44469550-44469572 CATGCACTACCACACCCGGCTGG - Intergenic
1190018090 X:46846045-46846067 CATGAACCACCACACCCAGCCGG + Intronic
1192915423 X:75646367-75646389 CCTGAAGTCCAGCACCCTGCAGG - Intergenic
1198211701 X:134522231-134522253 CATGAACTACCACACCCAGCTGG + Intergenic
1200546792 Y:4527691-4527713 CATGAAGTCCAAAACCCAACAGG - Intergenic
1201940215 Y:19450934-19450956 CATGAAGTCCAACACCCTGTGGG + Intergenic