ID: 1075324402

View in Genome Browser
Species Human (GRCh38)
Location 10:121519201-121519223
Sequence CTCCATGAGCAACTAGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075324399_1075324402 21 Left 1075324399 10:121519157-121519179 CCTATGGTTCTACTGGAAGAATG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1075324402 10:121519201-121519223 CTCCATGAGCAACTAGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075324402 Original CRISPR CTCCATGAGCAACTAGACAT GGG Intronic
No off target data available for this crispr