ID: 1075324484

View in Genome Browser
Species Human (GRCh38)
Location 10:121519976-121519998
Sequence CACCTTGAGAACCTTGAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 163}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075324474_1075324484 26 Left 1075324474 10:121519927-121519949 CCCATGAAGGAGACCCCAGTTGT 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG 0: 1
1: 0
2: 5
3: 15
4: 163
1075324480_1075324484 11 Left 1075324480 10:121519942-121519964 CCAGTTGTGGGTACCTTTAGATT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG 0: 1
1: 0
2: 5
3: 15
4: 163
1075324478_1075324484 13 Left 1075324478 10:121519940-121519962 CCCCAGTTGTGGGTACCTTTAGA 0: 1
1: 0
2: 0
3: 34
4: 395
Right 1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG 0: 1
1: 0
2: 5
3: 15
4: 163
1075324479_1075324484 12 Left 1075324479 10:121519941-121519963 CCCAGTTGTGGGTACCTTTAGAT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG 0: 1
1: 0
2: 5
3: 15
4: 163
1075324481_1075324484 -2 Left 1075324481 10:121519955-121519977 CCTTTAGATTCAGAAAGTCCTCA 0: 1
1: 1
2: 1
3: 18
4: 201
Right 1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG 0: 1
1: 0
2: 5
3: 15
4: 163
1075324475_1075324484 25 Left 1075324475 10:121519928-121519950 CCATGAAGGAGACCCCAGTTGTG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG 0: 1
1: 0
2: 5
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075324484 Original CRISPR CACCTTGAGAACCTTGAGGT AGG Exonic
900437790 1:2639783-2639805 CACCTTGAGTACCTCGGGGATGG - Intronic
900795791 1:4707538-4707560 CACCTTGAAAACCCTGAGCAGGG - Intronic
901547945 1:9973344-9973366 CACTTTGGGAAGCCTGAGGTTGG - Intronic
902616118 1:17624484-17624506 CACCTTGAGGAACTCGAGGAAGG - Exonic
904226054 1:29020886-29020908 CACCTTGGGAGTCTTGAGGCTGG - Intronic
906477028 1:46176216-46176238 CCCCTGGCTAACCTTGAGGTGGG + Exonic
907823668 1:57994761-57994783 CACCTGGAGATCCTTGTGGGTGG + Intronic
915616465 1:157043339-157043361 CCCCATGAGAACCTTGCTGTGGG - Intronic
915878524 1:159640715-159640737 CACCAAGAGAACCTTGAAGAAGG + Intergenic
917053469 1:170951653-170951675 CACCTTGATAATCTTCAGCTAGG - Intronic
917370010 1:174282687-174282709 CATCTTCACAACCTTGAGGTAGG - Intronic
921185163 1:212664312-212664334 CAGCTTGAGAAACTTGAGGTGGG + Intergenic
921663801 1:217841675-217841697 CACTTTGAGAGGATTGAGGTGGG + Intronic
923040019 1:230313100-230313122 CACCGTGGGAACCCTGAGGCTGG + Intergenic
924372774 1:243371099-243371121 CACATTGAGATCCTTGTGTTTGG + Intronic
924777533 1:247120321-247120343 CACCTTGAGAACAGTGAGGTAGG - Intergenic
924777562 1:247120443-247120465 CACCTTGAGAACAGTGAGGTAGG - Intergenic
924777576 1:247120504-247120526 CACCTTGAGAACAGTGAGGTAGG - Intergenic
1064117861 10:12594303-12594325 CATCTTGAGATGCTTGGGGTAGG - Intronic
1064237571 10:13590039-13590061 CATGTTGTGAACCTTGAGGGTGG - Intronic
1065726923 10:28676624-28676646 CACCTTGAGTACCTTGGGAAGGG + Intergenic
1065793062 10:29279300-29279322 CTACTTGAGAGGCTTGAGGTGGG - Intergenic
1067121218 10:43473777-43473799 CACTTTGGGAGGCTTGAGGTGGG + Intronic
1067769134 10:49110936-49110958 CACCTTCAGCACCAGGAGGTGGG + Intronic
1069890103 10:71647214-71647236 CACCTTGAGAAAGCCGAGGTGGG + Intronic
1070465334 10:76717024-76717046 CATCTTGAAAAGCTTGTGGTGGG + Intergenic
1071260929 10:83918369-83918391 CACCTTGAGAACATGGATGGTGG + Intergenic
1073071943 10:100800029-100800051 CACCTTGGGAGGCTTGAGGCAGG - Intronic
1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG + Exonic
1076574609 10:131455647-131455669 CTCTTTGACAACCTTGAGGCTGG - Intergenic
1077414449 11:2418242-2418264 CACCTTGGGCACCAGGAGGTGGG + Exonic
1078072276 11:8123344-8123366 CACCTTGAGAAACTAGAGAAAGG + Intronic
1078522854 11:12077285-12077307 CAGCCTGGGAACCTTGAGGAGGG + Intergenic
1081657477 11:44867063-44867085 AACCCTGAGCAACTTGAGGTTGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089157597 11:116414232-116414254 CAGCTTGAGAATCTGGAGGAAGG - Intergenic
1089365747 11:117919964-117919986 CACCTTGGGAACCTGGGGATAGG + Intronic
1090344786 11:126061693-126061715 CACCTTGAAAAACAGGAGGTTGG - Intronic
1091478787 12:804840-804862 AACCTTGAGAACATTAAGCTAGG - Intronic
1092745110 12:11665908-11665930 AAGCTTGAGAACCTTCAGGCTGG + Intronic
1093775105 12:23064530-23064552 CAGCTTGAGAAACTTGATGCAGG + Intergenic
1096697049 12:53356027-53356049 CTACTTGGGAAGCTTGAGGTGGG + Intergenic
1096929915 12:55196361-55196383 CACATTGAGAATGTTTAGGTTGG + Intergenic
1097982574 12:65749901-65749923 CACTGTAAGATCCTTGAGGTAGG - Intergenic
1098050282 12:66445823-66445845 CAGCTGGGGAACCTTGGGGTAGG + Intronic
1099246347 12:80197452-80197474 CACTTTGGGAGACTTGAGGTCGG - Intergenic
1101033527 12:100683010-100683032 CACCTTGTGAAGCTGGAGGCAGG - Intergenic
1101085629 12:101232938-101232960 CACTTTGGGATGCTTGAGGTAGG + Intergenic
1102445996 12:113003200-113003222 TACCTTCAGAAACTTGAGGAAGG + Intronic
1102624361 12:114222683-114222705 AACCTTGTGAACCCTGAGGCTGG - Intergenic
1103382048 12:120501631-120501653 CACATTGGGAGGCTTGAGGTGGG + Intergenic
1103659691 12:122503834-122503856 CACTTTGGGAGCCCTGAGGTGGG + Intergenic
1105734428 13:23253393-23253415 TATATTGAGAACCTTGAGCTAGG + Intronic
1108463031 13:50686417-50686439 CAGCTTGAACACCTTGAGGTTGG + Intronic
1109176320 13:59161334-59161356 CATCTTGAGAACCTGGAGGTGGG - Intergenic
1109302845 13:60607021-60607043 CACTTTGGGAAAGTTGAGGTGGG - Intergenic
1109807347 13:67460643-67460665 CACCTTGAGAACAATCTGGTGGG + Intergenic
1110940423 13:81341711-81341733 CTACTTGAGAGGCTTGAGGTAGG + Intergenic
1114193676 14:20459485-20459507 CTCAATGAGAACCTTGGGGTGGG + Intronic
1115586103 14:34814720-34814742 CACTTTGGGAGGCTTGAGGTGGG - Intronic
1116763925 14:49047982-49048004 CACCTTCAGAACCTTGTCTTTGG - Intergenic
1119835149 14:77742808-77742830 CACTTTGGGAAGGTTGAGGTGGG - Intronic
1120651301 14:87136373-87136395 TACCTTCATAACCTTGAGGTTGG - Intergenic
1121641038 14:95485048-95485070 CACTTTGAGAACCATGGGCTTGG + Intergenic
1125832053 15:42723953-42723975 CACTTTGAGAGGCCTGAGGTCGG - Exonic
1128031001 15:64479987-64480009 CACTTTGGGAGGCTTGAGGTGGG + Intronic
1128669242 15:69561891-69561913 CGACTTGTGAAGCTTGAGGTTGG + Intergenic
1133004814 16:2873928-2873950 CACTTTGAAAGGCTTGAGGTAGG - Intergenic
1134605986 16:15571598-15571620 CACTTTGGGAGGCTTGAGGTGGG - Intronic
1135146184 16:19964801-19964823 CACCTTGAGGACATTGTGCTAGG - Intergenic
1135584621 16:23659511-23659533 GACTTTGGGAACCTTGAGGCAGG - Intronic
1135655974 16:24249895-24249917 CACCTTGGAAACTTTGAGGGTGG + Intergenic
1135767779 16:25192685-25192707 CACTTTGGGAGGCTTGAGGTAGG + Intergenic
1141093619 16:81147470-81147492 CACCTTGAGAGCTTTGAAGAGGG + Intergenic
1143463344 17:7118306-7118328 CACCTTGGGAAGCTGGAGTTGGG + Intergenic
1146388254 17:32396966-32396988 CACTTTGGGAGGCTTGAGGTGGG + Intergenic
1147808555 17:43150033-43150055 CACTTTGGGAGGCTTGAGGTGGG - Intergenic
1148676201 17:49446518-49446540 TACCTGAACAACCTTGAGGTGGG - Intronic
1152563554 17:81090307-81090329 CACCGTGAGAAGGTTGATGTCGG - Intronic
1155009886 18:21766790-21766812 CACTTTGGGAAGCCTGAGGTGGG + Intronic
1158948385 18:62467959-62467981 TAAGTTGAGAACCTTGAGATGGG - Intergenic
1162399606 19:10437108-10437130 CACCTTAAGAACCTTAAGAGTGG + Intronic
1162782103 19:13011816-13011838 CGCCTTGAGAACCTCCAGGGAGG - Intronic
1165038197 19:33049798-33049820 CAACTTGAGATCCTAGAGGCAGG + Intronic
1165800253 19:38545192-38545214 CACCTATAGAACCAGGAGGTAGG + Intronic
925831583 2:7901141-7901163 CATCTTCATAACCTTGGGGTAGG + Intergenic
926134836 2:10329305-10329327 AAGATTGAGGACCTTGAGGTGGG + Intronic
931565026 2:63607289-63607311 CACTTTGGGAAGCTTGAGATGGG + Intronic
933257833 2:80100670-80100692 CACCTGGAATACCTTGAGCTGGG - Intronic
937096012 2:119235673-119235695 CACCTTGAGGAGCTTGGAGTGGG + Intronic
938582918 2:132663519-132663541 CACTTTGGGAAGCTTGAGGTAGG - Intronic
942488821 2:176469088-176469110 CAACTTGAAAATCTTGAGTTTGG + Intergenic
944156134 2:196609593-196609615 CACATTAAGAATCTTGAGATAGG - Intergenic
945265551 2:207888115-207888137 CACCTTGAGATGCTGGAGGAAGG - Intronic
945484193 2:210375552-210375574 CACTTTGAGAAGCCGGAGGTGGG - Intergenic
948392098 2:237619464-237619486 TATCTTTGGAACCTTGAGGTAGG - Intergenic
1170793956 20:19530597-19530619 GACCTTGAGAATCTTTAGGCTGG - Intronic
1172704992 20:36876389-36876411 CCCCTTGAGAACCTTGGAGCAGG - Intronic
1174705330 20:52649447-52649469 TATGTTAAGAACCTTGAGGTGGG + Intergenic
1175933205 20:62503077-62503099 CTCCTAGAGAACCTTCAGGTGGG + Intergenic
1180799784 22:18626355-18626377 CACCTTGAGAAGCTGCAGCTGGG - Intergenic
1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181452964 22:23036126-23036148 CACTTTGAGAAGCTGGGGGTGGG + Intergenic
1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1182000291 22:26914380-26914402 CACCATTAGAACCTGGAGGGAGG - Intergenic
1184475070 22:44715892-44715914 CACTTTGAGAGGCTGGAGGTGGG - Intronic
950252073 3:11474351-11474373 CACCTTGAGAGGCCCGAGGTAGG + Intronic
950471322 3:13188276-13188298 CTCCATGTGAACCTTGAGGTGGG - Intergenic
951083400 3:18479732-18479754 CACTTTTATATCCTTGAGGTGGG + Intergenic
953514246 3:43574199-43574221 CACTTTGGGAAGCTTGAGGCAGG - Intronic
954196734 3:49001611-49001633 CACCTTCAGCTCCGTGAGGTTGG + Exonic
961178954 3:124860953-124860975 CACTTTGAGAGACTTGAGGCAGG + Intronic
961453740 3:127014356-127014378 TACCTTGAGGATCTTGGGGTCGG - Exonic
963397443 3:144751377-144751399 CAGCTTGTGAACTTGGAGGTGGG + Intergenic
964285877 3:155117789-155117811 CACCTTGAGGACCAGGGGGTGGG + Intronic
964493001 3:157257022-157257044 CTTCTTGAGAACCTGGAGTTTGG - Intergenic
966452870 3:180082041-180082063 AACCTAGATAACCTTGGGGTTGG + Intergenic
967094196 3:186163249-186163271 CACTTTGGGAAGCTTGAGGAGGG - Intronic
967261641 3:187648612-187648634 CAAACTGAGAATCTTGAGGTGGG - Intergenic
968197288 3:196717935-196717957 CACCTTGCGAAGCTTCAGTTTGG - Intronic
970892632 4:21065335-21065357 CAATTTGAGAACCTAGATGTTGG + Intronic
971326648 4:25650037-25650059 CACTTTGAGAGGCCTGAGGTGGG - Intergenic
973531130 4:51837929-51837951 CACTTTGAGAGGCTTGAGGCGGG + Intergenic
973790730 4:54375771-54375793 CTACTTGTGAACCTTGCGGTGGG + Intergenic
975774794 4:77774296-77774318 TTCCTTGACAAACTTGAGGTGGG - Intronic
975798049 4:78030589-78030611 CACATTTAGTAACTTGAGGTGGG + Intergenic
980082299 4:128357043-128357065 CATCTTAAGAACCTTGAGATAGG + Intergenic
981477905 4:145206937-145206959 CACCTGGAAAATCTTGAGATAGG - Intergenic
982243490 4:153324783-153324805 CACCTTGAGAAGCCTGATCTAGG - Intronic
989610620 5:43287228-43287250 AAGGTTAAGAACCTTGAGGTGGG - Intergenic
994101132 5:95894002-95894024 CACTTTGTGAGGCTTGAGGTGGG + Intronic
998138124 5:139685094-139685116 CACCTCCAGAACCTCGAGGAGGG + Intergenic
998524089 5:142826660-142826682 CTTCTTGAGACCCATGAGGTGGG + Intronic
999873350 5:155774758-155774780 CAAGTTAAGGACCTTGAGGTGGG - Intergenic
1000000713 5:157136223-157136245 GACTCTGAGAACCTTGAGGAAGG - Intronic
1002126856 5:177052051-177052073 CACCTTGGGAAGGCTGAGGTGGG + Intronic
1002520622 5:179791612-179791634 CTACTTGAGAGGCTTGAGGTGGG + Intronic
1003014010 6:2453301-2453323 CACCTTGAGAACATTATGCTAGG - Intergenic
1006169262 6:32083769-32083791 CTACTTGAGAGGCTTGAGGTGGG - Intronic
1015788516 6:136943134-136943156 CACTTTGACAAACTTGAAGTAGG - Intergenic
1016704112 6:147087188-147087210 AACCTTGAGAACATTAAGCTAGG + Intergenic
1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG + Intergenic
1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG + Intronic
1022101602 7:27172696-27172718 CTCCTGGAGAAACTTGAGGGAGG - Intronic
1023287546 7:38634548-38634570 CTCCTTAAGAACCCTGAGCTAGG + Intergenic
1026926474 7:74197625-74197647 GACCTTGCCTACCTTGAGGTAGG + Intergenic
1027201819 7:76068692-76068714 CAGCTGGATAACCTTGAGGGTGG + Intergenic
1027544100 7:79504835-79504857 AATCTTAAGAACCTTGGGGTGGG - Intergenic
1028678396 7:93495163-93495185 CACCTTGAGAACTTTCAAATTGG + Intronic
1031401209 7:121328222-121328244 CACCATGAGAATCGTAAGGTAGG + Intronic
1034639105 7:152588452-152588474 CGCCTTGGGAGACTTGAGGTGGG + Intergenic
1035397259 7:158543271-158543293 CACCTTCAGAGCCTCGGGGTGGG - Intronic
1036635379 8:10546925-10546947 CACTTTGAGAGGCTTGAGGTGGG - Intronic
1037621807 8:20570489-20570511 GACTTTGAGCACTTTGAGGTGGG - Intergenic
1039437467 8:37569926-37569948 CACCTTGTGATCCCTGAGGTAGG + Intergenic
1041738269 8:61133588-61133610 CACCTTGAGGGGCTTGAGGTTGG + Intronic
1042130537 8:65583012-65583034 CTACTTGAGAGGCTTGAGGTGGG + Intergenic
1046316470 8:112509333-112509355 CACTTTGGGAGGCTTGAGGTGGG - Intronic
1047610746 8:126518525-126518547 CACCTGGAGAAGACTGAGGTTGG + Intergenic
1047861621 8:128973243-128973265 CACCTTGAGCACCTTGATGGTGG + Intergenic
1050719083 9:8564451-8564473 CACTTTGAGAAGCTGGAGGCGGG + Intronic
1050767151 9:9149126-9149148 CACCTGGATAACCTTGAGCAAGG + Intronic
1051157831 9:14170529-14170551 CTACTTGAGAGGCTTGAGGTGGG + Intronic
1052169048 9:25371686-25371708 ACCCATGAGAACCTTGGGGTGGG + Intergenic
1053104672 9:35399438-35399460 CACCCAGAGTACCTTGAGTTTGG - Exonic
1056396039 9:86182079-86182101 CACTTTGAGAGGCTTGAGGTGGG - Intergenic
1056897114 9:90561381-90561403 CAAGATAAGAACCTTGAGGTTGG + Intergenic
1058041799 9:100310682-100310704 CACTTTGGGAGTCTTGAGGTAGG - Intronic
1058763777 9:108161916-108161938 CACCTTGAAAACCTTGACAATGG + Intergenic
1060783303 9:126429868-126429890 GACCCTGAGAACCCTGAGCTGGG + Intronic
1062508976 9:136894477-136894499 CCCCTTGGCAACCCTGAGGTGGG - Intronic
1185825631 X:3246512-3246534 CACTTTGATCACCTTAAGGTAGG - Intergenic
1185869458 X:3651671-3651693 CATTTTGAGAAACTTGATGTGGG - Intronic
1186579738 X:10804961-10804983 CACCATGAGAACCTTGTGGGGGG + Intronic
1187056863 X:15748801-15748823 CACTTTGGGAGGCTTGAGGTGGG + Intronic
1187963290 X:24586391-24586413 GACCTTCAGATTCTTGAGGTAGG - Intronic
1188553409 X:31385079-31385101 AACCTTGTGAACCTTCATGTAGG - Intronic
1190582681 X:51903781-51903803 CACCGGGAGAAGCCTGAGGTAGG - Intergenic
1190726951 X:53195964-53195986 CTCCTTGAGAGCCTGGATGTTGG + Exonic
1190797500 X:53759036-53759058 CACATTGAAGATCTTGAGGTGGG - Intergenic
1190929170 X:54933816-54933838 CACCGGGAGAAGCCTGAGGTAGG - Exonic
1191791395 X:64975934-64975956 CAACTTCAGAACCTGGAGTTCGG - Intronic
1200353939 X:155527755-155527777 AATGTTGACAACCTTGAGGTAGG + Intronic
1201409976 Y:13689888-13689910 CACTTTGGGAGGCTTGAGGTGGG - Intergenic