ID: 1075324970

View in Genome Browser
Species Human (GRCh38)
Location 10:121524262-121524284
Sequence GGGGAGTGGAGGTGGTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 906
Summary {0: 1, 1: 0, 2: 11, 3: 117, 4: 777}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075324970_1075324978 -1 Left 1075324970 10:121524262-121524284 CCTCTTAACCACCTCCACTCCCC 0: 1
1: 0
2: 11
3: 117
4: 777
Right 1075324978 10:121524284-121524306 CCTCCGCCCTTTCTCACTTCTGG No data
1075324970_1075324982 18 Left 1075324970 10:121524262-121524284 CCTCTTAACCACCTCCACTCCCC 0: 1
1: 0
2: 11
3: 117
4: 777
Right 1075324982 10:121524303-121524325 CTGGTAGAAAAACTGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075324970 Original CRISPR GGGGAGTGGAGGTGGTTAAG AGG (reversed) Intronic
900158418 1:1212580-1212602 GGGGGGTTGGGGTGGTTAGGAGG - Intronic
901031961 1:6312212-6312234 GGCCAGGGGAGATGGTTAAGGGG + Intronic
901110570 1:6790275-6790297 CAGGAGTGGGGGTGGTGAAGAGG + Intronic
901778621 1:11577714-11577736 GGGGAGTGGGGCTGGTTGGGGGG - Intergenic
901840741 1:11952522-11952544 TATGAGTGGAGGTGGATAAGAGG + Intronic
902308947 1:15565757-15565779 GGCGGGTGGAGGTGGTGGAGGGG - Intronic
902728103 1:18350704-18350726 GGGGAGATGAGGTGGGTGAGTGG - Intronic
903190728 1:21654099-21654121 TGGGAGTGGGGGTGGTTAGTGGG + Intronic
903866592 1:26403162-26403184 TGGGAGTGGAGGAGGTGGAGTGG + Intergenic
903946567 1:26967773-26967795 GGGGTGTGGAGGTGAGGAAGGGG - Intergenic
904071980 1:27807321-27807343 GGGAAGTGGGGATGGTTAATGGG - Intronic
904408716 1:30311947-30311969 GGGAAGTGAAGGTGGGTGAGGGG + Intergenic
904491685 1:30864396-30864418 GGGGTGGGGAGGAGGTGAAGGGG + Intergenic
904501226 1:30913870-30913892 GGGGAGGGGAGCTGCTTGAGGGG + Intergenic
904614435 1:31742347-31742369 GGGGAGGGGAGGGGGTTATGAGG + Intronic
904702402 1:32365789-32365811 GGGGAGTTGAGGTGGGTAGCTGG + Intronic
904748472 1:32725768-32725790 GGGAAGTGGAGGTGGTTGGCTGG - Intergenic
906103289 1:43276754-43276776 GGGGGTTGGGGGTGGTGAAGAGG - Intergenic
906279476 1:44543326-44543348 GGGGAGGGGAGGGGGTGATGGGG + Intronic
906392188 1:45427782-45427804 GGGGAGTGGGGGCAGTTAATGGG + Intronic
906509051 1:46400810-46400832 GGGTAGGGGAGGAGGGTAAGAGG + Intronic
907014622 1:50999806-50999828 GGGAAGTGGGGATGGTTAATGGG + Intergenic
907073265 1:51556505-51556527 GAGTAGTGGAGATGGTTAATGGG + Intergenic
907090338 1:51718232-51718254 GGGGAGTGGGGATGGTTAATGGG + Intronic
907091521 1:51729808-51729830 GGGGGGTGAAGGGGGTGAAGGGG + Intronic
907256455 1:53182791-53182813 GGGGAGTGGAGGTGGAGCTGGGG + Intergenic
907401957 1:54229752-54229774 AGGGAGTGGAGGTGGTGGAATGG + Intronic
907856388 1:58307765-58307787 GGGGAGTGGGGGTGGAGGAGGGG + Intronic
907928422 1:58976399-58976421 TGGGAGTGGAGGTGGGTACAAGG - Intergenic
908464324 1:64376683-64376705 GGGAAGTGGGGATGGTTAATGGG - Intergenic
908809796 1:67968799-67968821 GGGAAGTGGGGATGGTTAATGGG - Intergenic
909999970 1:82330396-82330418 GAGGTGTGGAGCTGGTAAAGTGG - Intergenic
910071088 1:83214116-83214138 GGTGAGTGGAGGTGGGTGGGTGG - Intergenic
910183565 1:84511023-84511045 GGGGACTGGGGATGGTTAATGGG + Intergenic
910378691 1:86601744-86601766 GGGCAGTGGGGATGGTTAATGGG - Intergenic
910545963 1:88419371-88419393 GGGAGGTGGGGGTGGTTAATGGG + Intergenic
910797556 1:91114215-91114237 GAGGAGTGGAGATGGTTAATAGG + Intergenic
911239132 1:95446569-95446591 GGGGAGTGGGGATGTTTAATGGG - Intergenic
911470407 1:98311017-98311039 GGGATGTGGAGATGGTTAATTGG + Intergenic
911670834 1:100605636-100605658 GGGAGGTGGAGATGGTTAATGGG + Intergenic
912140988 1:106726907-106726929 GGAAGGTGGAGGTGGTTAATGGG + Intergenic
912183161 1:107242737-107242759 AGGGAGAGGAGGTGGTCGAGTGG - Intronic
912432332 1:109635222-109635244 GGGGAGTGGAGGGGAGCAAGTGG + Intergenic
912497306 1:110099900-110099922 GAGGATTGGAGGTGGGCAAGAGG - Intergenic
912502523 1:110131473-110131495 AGGCAGTGGAGGGGGTTAGGCGG + Intergenic
912638944 1:111325134-111325156 TGGGCATGGAGGTGGTAAAGTGG + Intergenic
912703541 1:111895711-111895733 GGGGAGTGGAGGGGGCCAGGGGG + Intronic
912742235 1:112211019-112211041 AGGGAGTGGGGATGGTTAATGGG + Intergenic
913096170 1:115517794-115517816 TGGAAGTGGAGATGGTTAATGGG - Intergenic
913498859 1:119452406-119452428 AGGGATGGGAGGTGGTTAGGGGG - Intergenic
913585566 1:120272256-120272278 GGGAAGTGGAGGTGGGGAGGAGG - Intergenic
913622618 1:120626111-120626133 GGGAAGTGGAGGTGGGGAGGAGG + Intergenic
914567572 1:148884115-148884137 GGGAAGTGGAGGTGGGGAGGAGG - Intronic
914605250 1:149246130-149246152 GGGAAGTGGAGGTGGGGAGGAGG + Intergenic
914719323 1:150276418-150276440 GCTGGGTGGAGGTGGTGAAGGGG + Intronic
914953693 1:152142839-152142861 GGGAGGTGGAGATGGTTAATGGG + Intergenic
914970020 1:152300305-152300327 GGTAAGTGGAGATGGTTAATGGG + Intergenic
915512310 1:156392917-156392939 GGGCGGTGGAGGTGGTGAGGAGG + Intergenic
915794303 1:158711416-158711438 GGGGAGTGGGGATGGTTAATTGG - Intergenic
916278416 1:163021556-163021578 GGGAAGTGGAGATGGTTAGTGGG + Intergenic
916681394 1:167108428-167108450 GGGGAGTGGGGGTGGATTAAGGG - Intronic
916729712 1:167555054-167555076 GAGGAGTGGGGATGGTTAATGGG - Intergenic
916977910 1:170101283-170101305 GAGGTGTGGGGGTGGTTAATTGG + Intergenic
917694549 1:177508540-177508562 GGGGTGTGTAGGTGGTGATGAGG - Intergenic
918027742 1:180769408-180769430 GGGTAGTGGGGGAGGTTAGGGGG - Intronic
918514434 1:185346916-185346938 AGGGAGGGGAGGTGGTCCAGTGG - Intergenic
919059955 1:192619762-192619784 GGAGAGTGGAAGTGGATATGTGG + Intergenic
919512147 1:198478429-198478451 GGGAAGTGGGGGTGATTAACAGG + Intergenic
919795041 1:201316519-201316541 AGGCAGTGGGGGTGGTTACGGGG - Intronic
920291563 1:204927231-204927253 TGGGGGTGGAGGTGGGGAAGAGG - Intronic
920441117 1:205980876-205980898 GGGAAGCGGAGGAGGTGAAGGGG - Intronic
920658042 1:207891013-207891035 GGGGAGCGGGGGTGCTCAAGGGG - Intronic
920894217 1:210028412-210028434 GGGGAATGGAGTTGTTTAATGGG - Intronic
921295623 1:213699175-213699197 GGGAAGTGGGGATGGTTAATGGG - Intergenic
921529287 1:216260837-216260859 GGGGAGTTGTGGTGGTAAAGGGG - Intronic
921928856 1:220736709-220736731 GGGTAGTGGGGATGGTTAATGGG - Intergenic
922006198 1:221532986-221533008 TGGAAGTGGAGGTGGAGAAGTGG + Intergenic
922191225 1:223320320-223320342 GGGGAGGGAAGGTGGGTATGGGG + Intronic
922196134 1:223362698-223362720 GGGGCGTGGAGGAGGTGCAGAGG - Intronic
922427697 1:225514785-225514807 TGGGAGTGGAGGAGGTGGAGGGG + Exonic
924095599 1:240547598-240547620 AGGGAGTAGAGGTGGAGAAGAGG + Intronic
924481431 1:244439007-244439029 GGGGTGGGGAGATGGTTAATGGG - Intronic
924907087 1:248467279-248467301 GGGTACTGGGGGTGGTGAAGGGG - Intergenic
1063167925 10:3480628-3480650 GGGGGGTGGAGGAGGTTCAGGGG - Intergenic
1063305444 10:4895205-4895227 GGGAAGTGGAGGTGGTTAATGGG - Intergenic
1063701372 10:8388205-8388227 AGGGAGTGCCTGTGGTTAAGGGG + Intergenic
1063866135 10:10367325-10367347 TGGGAGTGAAGGTGGGGAAGCGG - Intergenic
1063972506 10:11390940-11390962 GGGAAGTGGGGATGGTTAATAGG + Intergenic
1064074027 10:12254716-12254738 GGGGAGGGGAGGCGGTGCAGTGG - Intergenic
1065589661 10:27251961-27251983 GGGGAGGGGAGGGGGTTCCGGGG - Intergenic
1065876909 10:30005163-30005185 GGGGAGTGAGGATGGTTAATGGG - Intergenic
1065981034 10:30897545-30897567 GGGGAGTGGAGGTGGCTGGGTGG - Intronic
1066282020 10:33926838-33926860 GGGGAGTGGAGATGGTTAATGGG + Intergenic
1067089886 10:43261208-43261230 GGGGAGTGGTGGTGGTGGAGAGG - Intronic
1067306312 10:45067698-45067720 GGGGAGTGAGGATGGTTAATGGG - Intergenic
1067345090 10:45432030-45432052 GGGGTGTGGTGGTGGTGAAGAGG + Intronic
1067457472 10:46430216-46430238 GGGAAATGGAGATGGTTAATGGG - Intergenic
1067629724 10:47954418-47954440 GGGAAATGGAGATGGTTAATGGG + Intergenic
1067735188 10:48845136-48845158 GGGGAGTGGGAGTGGCTCAGAGG + Intronic
1068103468 10:52584729-52584751 GGGAAGTGGAGATGGTTAATGGG - Intergenic
1068229102 10:54147913-54147935 GGGGAGTGGAAGTGGGAAAGGGG + Intronic
1068721997 10:60255894-60255916 GGGGCCCAGAGGTGGTTAAGAGG + Intronic
1068833950 10:61531372-61531394 GGAGAGTGGGGATGGTTAAACGG + Intergenic
1068967104 10:62923781-62923803 GGGGAGTGTGGATGGTTAATGGG + Intergenic
1069055942 10:63844823-63844845 TGGGAGTGGAGAGGGTCAAGAGG + Intergenic
1069394282 10:67971646-67971668 GGGGGGTGGGGGTGGTTAGATGG - Intronic
1069666320 10:70162485-70162507 GGGGAGGGGAGGAGGGGAAGGGG + Intronic
1069927351 10:71859950-71859972 GGGGAGGGGAGGTGGTATGGAGG + Intergenic
1070329725 10:75408642-75408664 GGGGCGTGGGGGTGGTGAACCGG + Intergenic
1070418274 10:76210269-76210291 AGGGGGTGGAGGTGGGGAAGAGG + Intronic
1070837365 10:79457874-79457896 GGGGAATGGAGATGGTTAATTGG + Intergenic
1071345459 10:84687853-84687875 TGGGAGATGAGGTGGTGAAGAGG + Intergenic
1071518713 10:86315826-86315848 GGGGATTGGAGCTGGATAGGTGG - Intronic
1071591544 10:86879090-86879112 GGGGACTGTAGTTGGTTATGTGG + Intronic
1071825973 10:89326455-89326477 GGGAAGTGGGGATGGTTAATGGG + Intronic
1072041249 10:91608836-91608858 AGGGAGTGGAGGTGGGGCAGGGG + Intergenic
1072228625 10:93393765-93393787 GGGGAGTGGAGGTAGGGCAGGGG - Intronic
1072720259 10:97775990-97776012 GGGGAGTGGGGTTTGTTGAGGGG + Intergenic
1072912074 10:99511204-99511226 GAGGAGTGGGGGTGGTTAATGGG + Intergenic
1073115960 10:101091727-101091749 GGGGATTGGAGGTGGTGAAGTGG + Intronic
1073813760 10:107181985-107182007 AGGGAGTGGGGATGGTTAATGGG + Intergenic
1073872937 10:107886938-107886960 GGGGAGTGGAGATGGTTAGTAGG + Intergenic
1074123280 10:110508963-110508985 GGGAAGTGGAGGGTGGTAAGGGG + Intronic
1074782261 10:116810427-116810449 GGGCAGGGGAGGTGGTAGAGAGG - Intergenic
1075159302 10:120009461-120009483 GGGGATTGGAGGTGTCTAGGAGG - Intergenic
1075324970 10:121524262-121524284 GGGGAGTGGAGGTGGTTAAGAGG - Intronic
1075627312 10:123972474-123972496 GGGGAGGGGAGGAGGTGAAAGGG + Intergenic
1076377186 10:129999021-129999043 GGGGAGTGGAGATGGTGAATGGG + Intergenic
1076812982 10:132898807-132898829 GAGGAGGGGAGGGGGTTAAGGGG - Intronic
1078037210 11:7819577-7819599 GGGAAGTGAAGATGGTTAATTGG + Intergenic
1078121417 11:8513929-8513951 GGGAAGTGGGGGTGGTTAATTGG - Intronic
1078170895 11:8928535-8928557 GGAGGGTGGAGGTGGGTAACGGG - Intronic
1078715888 11:13838556-13838578 GAGGAGTGGGGGTGGTGATGAGG - Intergenic
1078786338 11:14498053-14498075 GGGAAGTGGAGATGGTTAATGGG + Intronic
1079271817 11:18994142-18994164 GGGAAGTGGGGATGGTTAATAGG - Intergenic
1080008288 11:27432248-27432270 GGGGAGAGAAGGTGTTCAAGTGG - Intronic
1080092066 11:28360293-28360315 GGGGAGTGGAGTGGGATGAGAGG - Intergenic
1080321877 11:31019488-31019510 GGGGTGGGGAGGTGGTGCAGTGG + Intronic
1080543245 11:33289782-33289804 AGGGAGTAGAGATGATTAAGGGG - Intronic
1081049648 11:38322225-38322247 GGGCAGTGGGGATGGTTAATGGG + Intergenic
1081364932 11:42222909-42222931 GGGAAGTGGAGATTGTTAATGGG + Intergenic
1081407925 11:42719371-42719393 AGGAAGTGGAGATGGTTAATGGG + Intergenic
1081633087 11:44702550-44702572 GGGCAGTGGAGATGGCTGAGGGG + Intergenic
1082025283 11:47566724-47566746 GGGGAGGGGAGAGTGTTAAGGGG - Intronic
1082185467 11:49175236-49175258 GGGGAGTGCAGGTGGTTTTGAGG + Intronic
1082766870 11:57176102-57176124 GGAGAGTGGAGGTGGGAAGGAGG - Intergenic
1082889632 11:58125226-58125248 GGGGGGGGGCGGTGGGTAAGGGG - Intronic
1083177928 11:60964399-60964421 GGGGAGTGGGGATGGTTAATGGG - Intergenic
1083762201 11:64824667-64824689 GAGGAGTAGAGGTGGTAAATGGG + Intronic
1084310085 11:68312127-68312149 TGGGAGTGGAGGTGGGTTTGAGG - Intergenic
1084750998 11:71204502-71204524 GGGGAGAGGAGGTGAGCAAGCGG - Intronic
1085675440 11:78513363-78513385 GTGAAGTGGGGGTGGTTAATAGG - Intronic
1085778061 11:79383684-79383706 GGGGAGTGGGAGGGGTCAAGAGG - Intronic
1086680860 11:89670104-89670126 GGGGAGTGCAGGTGGTTTTGAGG - Intergenic
1087031350 11:93708268-93708290 GGGGAGTGGGGATGGTTAATGGG - Intronic
1087091855 11:94281711-94281733 GAGGAGGGGAGGTGGTAAAGGGG + Intergenic
1088714349 11:112535834-112535856 GAGGAGTGCAGGTGGTCAACTGG + Intergenic
1088821992 11:113464340-113464362 GGGTAGGGGAGGTGGTAATGAGG - Intronic
1088943584 11:114485626-114485648 GGGGAGTGGGGATGATTAATGGG - Intergenic
1089690782 11:120185550-120185572 GGGGAGGGGAGGTTGTTGAGGGG - Intergenic
1090206669 11:124887967-124887989 GGGGTGTGGAGGGGATTCAGGGG - Intronic
1090485560 11:127109109-127109131 TGGGAGTGGAGGAGATTTAGGGG + Intergenic
1090556480 11:127882230-127882252 GGGAAGTCTAGGTGGTGAAGGGG - Intergenic
1091169799 11:133509920-133509942 GGGGAGTGGATGTGGGCATGAGG - Intronic
1091600429 12:1914662-1914684 GGGCAGTGGGGGTGGTTCGGGGG - Intronic
1091686001 12:2563014-2563036 GGGTAGTGGAGATGGTAAATAGG - Intronic
1091738226 12:2940870-2940892 GGGGGGTGGTGGTGGTGACGAGG - Exonic
1091925801 12:4347424-4347446 GGGAAGTGGGGATGGTTAATGGG + Intronic
1091966561 12:4747347-4747369 GGGGAGAGGGGATGGTTAATGGG - Intronic
1091996632 12:4999001-4999023 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1092298193 12:7219312-7219334 GGGGAGTGAGGATGGTTAATGGG - Intergenic
1092429794 12:8399182-8399204 GGGGAGGGGTGGTGGGTAGGAGG - Intergenic
1092482736 12:8875138-8875160 GGGCAGTGGCGGAGGTTGAGTGG + Intronic
1092757532 12:11777742-11777764 GGGGGGTGGAGGTGGGTCAGGGG - Intronic
1093532107 12:20177862-20177884 GGGAAGTGGAGATGGTTAATAGG + Intergenic
1093534797 12:20210232-20210254 GGGGAGAGGAGGTGGGAAGGGGG - Intergenic
1093931265 12:24956999-24957021 AGGAAGTGGAGGTGGAGAAGAGG - Intergenic
1094086008 12:26592274-26592296 GGGAAGTGGGGATGGTTAATGGG + Intronic
1094631301 12:32177607-32177629 GAGTGGCGGAGGTGGTTAAGGGG + Intronic
1094783323 12:33818210-33818232 GGGTTGTGGAGGTGGGTAGGTGG + Intergenic
1095181113 12:39147386-39147408 GGGGAGTGGGTATGGTTAATGGG - Intergenic
1096144405 12:49267785-49267807 GGGGAGTGTAGGTGGGAAGGAGG + Intronic
1096581991 12:52591642-52591664 GGGGAGGGGAGCTAGTTAAGGGG + Intronic
1096741931 12:53699795-53699817 GGGGAGTGGGGGTGGCCAGGAGG + Intergenic
1097245363 12:57604945-57604967 GGGGAGGGGAGGTGGAGGAGGGG - Intronic
1097387887 12:58972460-58972482 GGGTTGTGGAGATGGTTAATGGG - Intergenic
1097956408 12:65490319-65490341 AGGGAGTGGAGGTGGGGAATGGG + Intergenic
1098049677 12:66440432-66440454 GGGGAGTGGGGATGGTTAATGGG - Intronic
1098207321 12:68125699-68125721 GGGGAGTGGGGATGGTTAATGGG - Intergenic
1098305002 12:69094215-69094237 GGGGAGTGGAAATGGTTAATGGG + Intergenic
1098396492 12:70023793-70023815 GGGAAGTGGAAATGGTTAATAGG + Intergenic
1098405847 12:70124799-70124821 GGGGAGTGGGGATGGTTAATGGG + Intergenic
1098531729 12:71549287-71549309 TGGGAGTGGGAGTGGTTGAGTGG + Intronic
1098534530 12:71579756-71579778 GGGAAGTGGGGATGGTTAATGGG - Intronic
1098898805 12:76091731-76091753 GGGGAGTGGAGGGGTGTATGTGG + Intergenic
1100122975 12:91390702-91390724 GGGGAGTGGGTATGGTTAACGGG - Intergenic
1100903882 12:99275319-99275341 GGGGACAGGGGGTGGTTAATAGG - Intronic
1100958112 12:99931897-99931919 GGGCAGTGGGGATGGTTAATGGG - Intronic
1101162033 12:101987583-101987605 TGGGAGTGGGGATGGTTAAAGGG - Intronic
1101249654 12:102919563-102919585 GGGAGGTGGAGATGGTTAATAGG - Intronic
1101764335 12:107684221-107684243 GGGGTGTGGAAGTGGAGAAGTGG + Intergenic
1101787202 12:107894551-107894573 GGGAAGTGGAGATGGTTGACTGG - Intergenic
1101954890 12:109204618-109204640 TGGGAGTGGGGATGGTTAACGGG - Intronic
1102238367 12:111308749-111308771 GGGGAGTGGAGCTCTTTAGGGGG - Intronic
1103421009 12:120782483-120782505 GGGCTGGGGAGGTGGGTAAGGGG + Intronic
1103949040 12:124541607-124541629 GGGGAGTGGAGATGGTGGGGGGG + Intronic
1104044382 12:125151542-125151564 GGGGAATGGAGGTGCCTCAGGGG + Intergenic
1104066873 12:125313662-125313684 GGGGAGGGGAGAGGGGTAAGGGG - Intronic
1105299180 13:19117639-19117661 TGGTAGTGGGGGTGGTTTAGGGG - Intergenic
1105844304 13:24281348-24281370 GGGGAGTGGAGGTGGGTAGAGGG + Intronic
1105936875 13:25108683-25108705 GGGGAGTGGTGATTGTTAATCGG - Intergenic
1106053720 13:26217996-26218018 GGGAAGTAGAACTGGTTAAGAGG + Intronic
1106620405 13:31366190-31366212 GGGGACTGGAGTTAGTTCAGAGG - Intergenic
1106984415 13:35328376-35328398 GGGGAATGGGGATGGTTAACAGG + Intronic
1107523549 13:41207045-41207067 GGGGAGTGGGGATGGTTAATGGG - Intergenic
1107664686 13:42676674-42676696 AGGGAGTGGGGATGGTTAATGGG - Intergenic
1107918089 13:45173520-45173542 GGGAAGTGGGGGTGGTTAGGAGG - Intronic
1108483258 13:50897314-50897336 AGGGAGTGGTGATGGTTAATGGG + Intergenic
1110078470 13:71280527-71280549 GGGGAGTGGGGATGGTTAATGGG - Intergenic
1110448173 13:75611664-75611686 AGGGAGTGGGGATGGTTAATGGG - Intergenic
1110974652 13:81814966-81814988 AGGAAGTGGAGATGGTTAATGGG + Intergenic
1110980424 13:81890155-81890177 GGGGTGTGGGGGTGTTTCAGTGG - Intergenic
1111225124 13:85260880-85260902 GGGGAGTGGAAGTGGAGAAGAGG - Intergenic
1112629171 13:101141608-101141630 GGGGAGGGGAGGTGAGAAAGAGG + Intronic
1113914920 13:113864338-113864360 GGGGAGTGGGGGTTGGAAAGAGG - Intergenic
1114093759 14:19311977-19311999 GGGAAGTGGGGATGGTTAATAGG - Intergenic
1114229564 14:20768331-20768353 TGGTAGTGGAGGTGGTGATGGGG - Intergenic
1114304480 14:21409359-21409381 AGGGAGAGGAGGAGATTAAGGGG + Intronic
1114499887 14:23160860-23160882 TGGGAGTGGAGGGAGTTAGGAGG - Intronic
1114533895 14:23411361-23411383 GGAGAATGGAGGTGGCTATGAGG + Intergenic
1114767448 14:25390133-25390155 GAGGATGGGATGTGGTTAAGGGG + Intergenic
1115861844 14:37695259-37695281 GTGAAGTGGGGGTGGTTAATGGG + Intronic
1116430739 14:44842541-44842563 GGGGTGTGGAGATGGGAAAGAGG - Intergenic
1116568593 14:46485511-46485533 TGAGGGTGGAGGTGGGTAAGAGG - Intergenic
1116747293 14:48836887-48836909 GGGGAGGGGAGGGAGTGAAGAGG - Intergenic
1116810234 14:49532841-49532863 GGGGGGTGGAGATGCTTAATGGG + Intergenic
1116912183 14:50480422-50480444 GGGGAGTGGGGATGGTTAATGGG - Intronic
1116944616 14:50824809-50824831 GGGAAGTGGAGGTGTGTAGGTGG - Intronic
1117870228 14:60192918-60192940 GGAAAGTGGAAATGGTTAAGGGG - Intergenic
1118232760 14:63968957-63968979 GGGAAATGGAGATGGTTAATGGG - Intronic
1118366683 14:65102377-65102399 GGGGAGGGGAAGGGGTGAAGGGG + Exonic
1118458553 14:65966942-65966964 AGGGGGTGGTGGTGGTGAAGAGG + Intronic
1118734545 14:68692012-68692034 GGGGAGTGAGGGTGGCTCAGGGG - Intronic
1119038543 14:71251436-71251458 GGGGAGTGGGGATGGTTAATGGG + Intergenic
1119651841 14:76389446-76389468 GGGGATTGGAAGTAGTTAAAGGG + Intronic
1119723260 14:76905914-76905936 GGGGAGTGGGGGTGGGGAGGCGG + Intergenic
1119764929 14:77182165-77182187 GGGGAACGGAGGTGGGTAGGAGG + Intronic
1120426761 14:84358169-84358191 AGGGAGTGGGGATGGTTAATAGG + Intergenic
1120698582 14:87672333-87672355 GGGAGGTGGGGGTGGTTAATGGG + Intergenic
1120736630 14:88060214-88060236 GGGGAGTGGCGATGGTTAATGGG + Intergenic
1120809166 14:88785209-88785231 GGGAAGTGGGGATGGTTAATGGG + Intronic
1121103942 14:91268701-91268723 GGGGAGTGAGGATGGTTAATGGG + Intergenic
1121131038 14:91447603-91447625 GGAGGGTGGAGATGGTTAATGGG + Intergenic
1121416044 14:93779943-93779965 GGGGGATGGAGGTGGTTTGGAGG - Intronic
1121821849 14:96976057-96976079 GGGAAGTGGAAGAGGTAAAGAGG - Intergenic
1202848731 14_GL000225v1_random:2201-2223 GGGGAGTGGGGGTGGGGAGGGGG - Intergenic
1123808838 15:23903074-23903096 AGGGAGTGGAGGGGGATAAGGGG - Intergenic
1123931138 15:25172171-25172193 GGGTAGTGGAGGTGCTTGTGGGG + Intergenic
1123931433 15:25173497-25173519 GGGGAGTGGAGGTGCTCCAGGGG + Intergenic
1123932426 15:25178282-25178304 GGGCAATGGAGGTGCTCAAGGGG + Intergenic
1125038579 15:35156508-35156530 TGGGAGTGGCGGGGGTAAAGGGG + Intergenic
1125090909 15:35791606-35791628 GGGGAGTGGAGTTGGTTAATGGG + Intergenic
1125180486 15:36877614-36877636 GAGGTGTGGAGGGGGCTAAGAGG + Intergenic
1125214741 15:37258453-37258475 GGGGAGTGTGGATGGTTAATGGG + Intergenic
1125267248 15:37897135-37897157 AGGAAGTGGAGATGGTTAATGGG + Intergenic
1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG + Intronic
1126016229 15:44353807-44353829 GGGAAGTGGGGATGGTTAATTGG + Intronic
1126441189 15:48690805-48690827 GGGAAATGGAGATGGTTAATGGG + Intergenic
1126486059 15:49182115-49182137 AGGGAGTGGGGATGGTTAATAGG - Intronic
1126704658 15:51396127-51396149 GCCAGGTGGAGGTGGTTAAGGGG - Intronic
1127061226 15:55187745-55187767 GGGGAGTGGGGTGGGGTAAGGGG + Intronic
1127406309 15:58651373-58651395 GGGAAGTGGGGATGGTTAACGGG - Intronic
1128401281 15:67284161-67284183 GGGAAGTGGGGATGGTTAATGGG - Intronic
1128717419 15:69918777-69918799 GGGGAGTGGTGGGGGTCAGGGGG + Intergenic
1128848336 15:70922548-70922570 GGGAGGTGGAGATGGTTAATGGG + Intronic
1128912170 15:71525482-71525504 AGGGAGTGGGGGTGGTTGAAAGG + Intronic
1128989859 15:72250804-72250826 GGGCAGTGGGGGTGGTGAGGGGG - Intronic
1129135783 15:73549370-73549392 GGGTAGTGGGGATGGTTAATGGG + Intronic
1129219900 15:74126090-74126112 AGGGGGTGGTGGTGGTGAAGAGG + Intronic
1129270086 15:74414988-74415010 GGTGAGTGGAGGTGGATGGGTGG - Intronic
1129584264 15:76847214-76847236 GGGAAGTGGAGATAGTTAATGGG + Intronic
1129685156 15:77681776-77681798 GGGGAGTGGAGGAGGGAAAGTGG + Intronic
1130713340 15:86306277-86306299 GGGAGGTGGAGATGGTTAATGGG - Intronic
1131268221 15:90931347-90931369 GGGCAGCGCAGGTGGTGAAGGGG - Exonic
1131887815 15:96937449-96937471 GGATAGTGGTGGTGGTGAAGGGG - Intergenic
1132049145 15:98592416-98592438 GGAGAGTGGAGGTGGGGAAATGG - Intergenic
1132417734 15:101635616-101635638 GGGGAGGGGCGGGGGTTCAGTGG + Intronic
1133034401 16:3026981-3027003 GGGGAGGGGAGGAGGGAAAGAGG - Intronic
1133278608 16:4652576-4652598 GGGCCGTGGAGGTGGCTATGTGG - Intronic
1133382666 16:5344473-5344495 AGGGAGGTGAGGTAGTTAAGAGG - Intergenic
1133720335 16:8488876-8488898 CGGGAGTGGTGGTGGTGAATAGG - Intergenic
1134438649 16:14284280-14284302 GGGGAGGGGAGGTGTTTATTGGG - Intergenic
1134800176 16:17077007-17077029 GGGGGGTGGAGAAGGTAAAGGGG - Intergenic
1134915534 16:18067593-18067615 GGGAAGTGGGGATGGTTAATGGG + Intergenic
1134976961 16:18578335-18578357 GGGAAATGGGGGTGGTTAATGGG + Intergenic
1135299853 16:21316500-21316522 GGGAAGTGGAGATGTTTAATGGG + Intergenic
1136419499 16:30123111-30123133 GGGAGGTGGAGATGGTGAAGGGG - Exonic
1137496163 16:48970988-48971010 GGGGATGGGATGTGGTTCAGGGG + Intergenic
1138360524 16:56424731-56424753 GGGCAGGGGAAGGGGTTAAGGGG - Intronic
1138888430 16:61110070-61110092 AGGAAGTGGAGGTGGTCAACAGG - Intergenic
1139261923 16:65602480-65602502 GGGTAGTGGTGGTGGTGATGGGG - Intergenic
1139580751 16:67872445-67872467 GGGAAGTGGGGGTGGGGAAGAGG + Exonic
1140624216 16:76772173-76772195 GGGAGGTGGAGATGGTTAATGGG - Intergenic
1141094754 16:81155135-81155157 GGGAAGATGAGGTGGTTAATGGG + Intergenic
1141187644 16:81799217-81799239 GGGGGGTGGCGGGGGCTAAGGGG - Intronic
1142069972 16:88086740-88086762 GTGGAGTGGAGGTGGGGAGGCGG - Intronic
1142191557 16:88720567-88720589 GGGGAGTGGGGGTGGGGAGGCGG - Intronic
1142257822 16:89023791-89023813 GAGCAGTGGAGGTGGGGAAGGGG - Intergenic
1142288937 16:89183895-89183917 TGGGAGTGGAGGTTTTTCAGGGG + Intronic
1142738443 17:1916573-1916595 GGGGACTGGGCGAGGTTAAGAGG + Intergenic
1143430766 17:6881549-6881571 GGGGAATGGAGATGGTCAATGGG - Intronic
1143448739 17:7023345-7023367 GGGGAGTGGCGGTGCTGGAGGGG + Intronic
1144218057 17:13074382-13074404 GGGGAGTGGAGGGGGGTGGGTGG - Intergenic
1144307390 17:13981431-13981453 GGGGAGTGGAGTGGGCTCAGAGG + Intergenic
1144726191 17:17503871-17503893 GGGGAGTGGAGGTGGGGAGCAGG + Intergenic
1144750835 17:17647089-17647111 GGGGATTGGAGGTGGGTTCGGGG + Intergenic
1145193479 17:20867561-20867583 TGGCAGTGGGGGTGGTTTAGGGG - Intronic
1145897091 17:28465491-28465513 GGGGAGTAGAGCTGGAAAAGAGG - Intronic
1145912771 17:28552227-28552249 GGGGAGGGGAGGCGGGAAAGGGG + Intronic
1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG + Intronic
1147487435 17:40830500-40830522 GGGAAGTGGGGATGGTTAATGGG + Intronic
1147966340 17:44196235-44196257 GGGGAGTGTGGGTGGGGAAGGGG - Intronic
1148081766 17:44970746-44970768 GGGTCGGGTAGGTGGTTAAGGGG - Intergenic
1148159600 17:45442359-45442381 GTGGAGTGCAGTTGGTGAAGGGG - Intronic
1148335118 17:46835805-46835827 GGGGAGTGAAGGGGGCTGAGGGG - Intronic
1148411465 17:47471090-47471112 GGGGAGTGGTGCTGGGTACGAGG - Intergenic
1148821733 17:50363915-50363937 GGGAAGTGGAGGTGGGCAATGGG + Intergenic
1149006954 17:51816044-51816066 GGGAGGTGGAGATGGTTAATGGG - Intronic
1149039124 17:52166515-52166537 GGGCAGTGGGGATGGTTAATGGG + Intergenic
1149469669 17:56905833-56905855 GGAGAGTGGGGGTGGTGAAGGGG + Intronic
1149913643 17:60588543-60588565 GGGGAGAGGACATGGTTAATGGG - Intergenic
1150390888 17:64789231-64789253 GCGGAGTGCAGTTGGTGAAGGGG - Intergenic
1150539741 17:66084687-66084709 GGGGAGTTGGGATGGTTAATGGG + Intronic
1150580898 17:66473065-66473087 GGGGAGTGGAGGAGGAGAGGTGG - Intronic
1151159284 17:72151073-72151095 GGGGAGGGGAGGTGGGGAAGGGG + Intergenic
1151167039 17:72213062-72213084 GGGGAGTAGGGGTGGTTAATGGG - Intergenic
1151807896 17:76417976-76417998 GAGAAGTGGAGGTGGAGAAGTGG + Intronic
1152248702 17:79200300-79200322 TGGGAGTGGCTGTGGTGAAGAGG - Intronic
1152727388 17:81954349-81954371 GGGGAGTGGGGGTGGAAAAGGGG - Intronic
1152900632 17:82939169-82939191 GGAGGGAGGAGGTGGTTAATGGG + Intronic
1153226635 18:2905607-2905629 GGGCAGTGGAGGTGGTTGATGGG - Intronic
1153690309 18:7585713-7585735 GAGGAGTGGCCATGGTTAAGTGG - Intronic
1153969839 18:10216050-10216072 GGGCAGTGGTGGTGGTGGAGGGG + Intergenic
1156133762 18:34010123-34010145 GGGAAGTGTAGATGGTTAATAGG - Intronic
1156371884 18:36478528-36478550 AGGGAGTGGGGATGGTTAATGGG - Intronic
1156967395 18:43111314-43111336 AGGGAGTGGAGATGGTTAATGGG + Intronic
1156993350 18:43437237-43437259 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1157174363 18:45437585-45437607 CTGCACTGGAGGTGGTTAAGTGG + Intronic
1157337518 18:46752526-46752548 GGGCAGTGCAGGTGGCTTAGTGG - Intronic
1157557105 18:48619941-48619963 GAGGAGTGGAGGTGGGTTAGAGG - Intronic
1157570199 18:48707105-48707127 GGGGAGTGCAGGAGGTGGAGGGG + Intronic
1157869338 18:51215616-51215638 GTGGTGTGGAGGTGCATAAGAGG - Intronic
1158343592 18:56491900-56491922 AGGGAGTGGAGGGCGCTAAGAGG - Intergenic
1158493781 18:57934408-57934430 GGGGACTGGGAGGGGTTAAGGGG - Intergenic
1158870185 18:61679128-61679150 GGATAGTGGGGATGGTTAAGGGG + Intergenic
1159939943 18:74399283-74399305 AGGGAAAGGAGGTCGTTAAGTGG - Intergenic
1160150331 18:76392928-76392950 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150359 18:76392997-76393019 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150396 18:76393089-76393111 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150406 18:76393112-76393134 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150489 18:76393324-76393346 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150508 18:76393370-76393392 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150555 18:76393490-76393512 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150603 18:76393605-76393627 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150742 18:76393955-76393977 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150768 18:76394016-76394038 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150815 18:76394136-76394158 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150880 18:76394302-76394324 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150899 18:76394348-76394370 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150918 18:76394394-76394416 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150965 18:76394514-76394536 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160151059 18:76394744-76394766 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160699017 19:497396-497418 GGAGAGAGGAGGGAGTTAAGAGG + Intronic
1161186712 19:2926405-2926427 GGGGAGCCGAGGTGGCTACGCGG - Intergenic
1161271025 19:3389351-3389373 GGGGAGTGGAGGGTGGGAAGGGG + Intronic
1161448295 19:4329903-4329925 GGGGACGGGAGGTGGTTGTGTGG - Intronic
1161649878 19:5477937-5477959 GGGGAGAGGAGGGGGTGAGGAGG - Intergenic
1162141710 19:8589395-8589417 GGGGAGCGGGGGTGGGTTAGGGG - Intronic
1162687839 19:12402004-12402026 GGGAAGTGGGGATGGTTAATAGG - Intronic
1162692160 19:12441808-12441830 GGGAAGTGGGGATGGTTAATAGG - Intronic
1163454661 19:17399380-17399402 GGTGAGTGGAGGAGGTCACGTGG + Intergenic
1163664431 19:18596628-18596650 GGGGAGTGGAGGCGGCTGTGGGG + Exonic
1164279937 19:23760236-23760258 GTGGAATGGAGGGGGTTAGGGGG - Intergenic
1164528939 19:29032724-29032746 GGGGTGTGGAGGTGGAGAAAAGG + Intergenic
1165334426 19:35159236-35159258 GGGGAGGGGAGGTGACAAAGGGG - Intronic
1165420651 19:35720576-35720598 GAGGGGTGGAGGAGGTGAAGGGG - Exonic
1165712783 19:38024021-38024043 GGGGGGTGGACGAGGTAAAGGGG + Intronic
1165738947 19:38194351-38194373 GGGGTTAGGAGGTGGGTAAGGGG - Intronic
1166356523 19:42230520-42230542 GGGGAGGGGAGGGGGCCAAGGGG + Exonic
1166756752 19:45197077-45197099 TGGGAGTGGAGGGGGCTGAGGGG + Intronic
1166872469 19:45879230-45879252 GGGGAGTGGAGGTGGGCGGGCGG - Intergenic
1166937407 19:46342893-46342915 GGGAAGTGGAGGGGGTTCTGGGG - Exonic
1166975355 19:46602184-46602206 GGGTCGTGGAGGTGGTGAAAAGG + Intronic
1167084538 19:47300227-47300249 AGGGAGTGGAGGGTGGTAAGTGG + Intronic
1167114355 19:47480189-47480211 GGGTAGGGGAGGAGGATAAGTGG - Intronic
1167566679 19:50261409-50261431 GGGGAGTGGGGGTGGTGAGGAGG - Intronic
1168288915 19:55347637-55347659 TGGGAGTGGGGGTGGCTCAGGGG - Exonic
1168362343 19:55752640-55752662 GGGAAGTGGGGATGGTTAATTGG - Intergenic
1168400177 19:56081053-56081075 GGGGAGTGGGAGTGGTTGCGGGG + Intergenic
1168726533 19:58585723-58585745 GGGGAGGGGAGGAGGGGAAGAGG - Intergenic
924963408 2:55317-55339 GGTGGGAGGGGGTGGTTAAGTGG + Intergenic
925052580 2:828754-828776 GGGCAGTGGTGGTGGTTCTGTGG - Intergenic
925357363 2:3251464-3251486 GTGGAGTGGGGGTGGTTGTGGGG - Intronic
925755399 2:7128100-7128122 GGGGAGGGGAGGAGGGAAAGGGG - Intergenic
926602336 2:14858689-14858711 AGGAAGTGGAGATGGTTAATGGG + Intergenic
926853238 2:17224125-17224147 GGGGAGTGGAGATAGTTAATGGG - Intergenic
927918084 2:26949364-26949386 GGGGAGCAGAGGTGGCGAAGGGG + Exonic
928064978 2:28154425-28154447 GGGGAGTGGTGGTGGTAAGGTGG + Intronic
928384809 2:30857996-30858018 GGGGAATGGGGGTGGTTAATGGG + Intergenic
928760880 2:34580681-34580703 GGGGAGAGGGGCTGGTTAATGGG + Intergenic
928763653 2:34614920-34614942 GGAGAGTGGAGGTTGTGAGGAGG + Intergenic
929732394 2:44509674-44509696 GGGGCCTTAAGGTGGTTAAGAGG + Intronic
929755536 2:44761096-44761118 AGGGAGTGGAGGTGGCCAACTGG + Intronic
929987189 2:46746190-46746212 GGGCAGTGGAGATGGAGAAGAGG + Intronic
930048890 2:47198399-47198421 GGGAAGTGGAGATGGTTAATGGG + Intergenic
930728285 2:54703489-54703511 GGGAAGTGGGGATGGTTAATGGG + Intergenic
930891812 2:56398774-56398796 GGTGGGTGGAGATGGTTAATAGG - Intergenic
931085152 2:58822071-58822093 GGGGAGTAGGGATGGTTAATGGG - Intergenic
931484607 2:62677607-62677629 GGGAAGTGGGGATGGTTAATGGG - Intronic
931603650 2:64030095-64030117 GAGGAGTAGTGGTGGTGAAGAGG + Intergenic
931905403 2:66837439-66837461 GGGAAGTGGGGATGGTTAATGGG - Intergenic
932187132 2:69707845-69707867 GGGTAGTGGGGATGGTTAATGGG - Intronic
932299944 2:70659604-70659626 GGAGAGTGGAGGGGGTCAACTGG + Exonic
932540729 2:72649221-72649243 AGGGAGTGGGGATGGTTAATGGG + Intronic
932858452 2:75263766-75263788 GGGAGGTGGGGATGGTTAAGGGG - Intergenic
933083468 2:78023984-78024006 GGGGAGTGGGGGTGGTTCCTGGG + Intergenic
934493791 2:94780589-94780611 GGAGAGTGGAGGGTATTAAGGGG - Intergenic
934543392 2:95194756-95194778 GGGAAGTGGGGATGGTTAATGGG + Intergenic
937187528 2:120058577-120058599 GTGGAGGGGATGTGGTGAAGTGG + Intronic
937212325 2:120282565-120282587 GGGGGGCGGGGGTGGGTAAGAGG + Intronic
937226051 2:120369487-120369509 GGGGTGTGGAGGTTGCTGAGGGG - Intergenic
937391708 2:121494472-121494494 AGGGAGTGGGGATGGTTAAAGGG + Intronic
937682329 2:124657392-124657414 GGGGAATGGAGATGGTGAAGAGG - Intronic
937793376 2:125986846-125986868 AGGGAGTGGGGATGGTTAATGGG - Intergenic
938072444 2:128315866-128315888 AGGGAGTGGAGGCGGAGAAGAGG + Intronic
939360574 2:141166653-141166675 GGGAAGTGGGGATGGTTAATGGG - Intronic
939963395 2:148586148-148586170 GGGAGGTGGAGATGGTTAATGGG + Intergenic
940160586 2:150708346-150708368 GGGGAGGGGAGGAGGGTAAGTGG + Intergenic
940374023 2:152936887-152936909 GGGCAGTGGAGATGATTAATGGG - Intergenic
940412786 2:153385560-153385582 GGGAGGTGGAGATGGTTAATGGG + Intergenic
940416844 2:153432716-153432738 GGGGTGGGGAGGTGGTTGGGGGG + Intergenic
940555452 2:155221163-155221185 AGGAAGTGGAGATGGTTAATAGG + Intergenic
940699812 2:157026690-157026712 GGGAAGTGTAGATGGTTAATGGG + Intergenic
940855879 2:158728463-158728485 GGGGAGGAGAGGTGGGGAAGTGG + Intergenic
941152672 2:161934283-161934305 GGCAAGTGGGGGTGGTTAATGGG - Intronic
941299412 2:163783102-163783124 AGGGGGTGGAGATGGTTAATGGG - Intergenic
941508393 2:166376008-166376030 GAGGAGTGGAGGAGGCAAAGCGG - Intergenic
941571227 2:167173242-167173264 GGGAAGTGAAGATGGTTAATGGG - Intronic
941721486 2:168817399-168817421 GGGGTGAGGAGGAGGTTAAGTGG + Intronic
941722812 2:168829826-168829848 GGGAAGGGGCAGTGGTTAAGGGG + Intronic
941851268 2:170184311-170184333 GGGGAGTAGGGATGGTTAATGGG - Intronic
941975798 2:171403799-171403821 GGGGTGGGGAGGTGGTTATAAGG + Intronic
942034010 2:171993118-171993140 GGGGAGTGGAGGTGGAGAGTGGG + Intronic
942064258 2:172255324-172255346 GTGGGGTGGAGGAGGTTAAGAGG - Intergenic
942648299 2:178138865-178138887 GGGGGATGGAGGTGGGTGAGGGG + Intronic
942778115 2:179609186-179609208 GGGAAGTGGGGATGGTTAATGGG - Intronic
943331762 2:186568222-186568244 GGGTAGTGGGGATGGTTAATGGG + Intergenic
943333285 2:186585927-186585949 TGGGAGTGGAAGTGGTTATGGGG + Intergenic
944154687 2:196596826-196596848 GGGAAGTTGAATTGGTTAAGTGG + Intergenic
944154942 2:196598372-196598394 GGGGAGGGGAGGAGGGGAAGGGG + Intergenic
944154967 2:196598421-196598443 GGGGAGGGGAGGAGGGGAAGGGG + Intergenic
944287028 2:197962711-197962733 GGGGAGTGGGGATGATTAATGGG - Intronic
944989981 2:205224515-205224537 GGGGAGTGGCGGTGGGGAAGTGG - Intronic
945711566 2:213303514-213303536 GGGGAGAGGGGATGGTTAATGGG - Intronic
946079973 2:217109476-217109498 GGGGAGTGGAGGTGGTGATGGGG + Intergenic
946304930 2:218851052-218851074 GGGGAGTGGAGGGTGGTAGGAGG + Intergenic
946757025 2:222957612-222957634 GGGAGGTGAAGGTGGTTAATAGG + Intergenic
946771657 2:223094850-223094872 GGGAAGTGGTTGTGGTAAAGGGG - Intronic
947072254 2:226302559-226302581 AGGGATTGGAGGAGGTTTAGTGG - Intergenic
947538636 2:230958547-230958569 GGGGAGTGGTGGTGGTTGCAGGG - Intronic
947881948 2:233523823-233523845 GGGGAGTGGGGGTGGTTTGGAGG - Intronic
948055521 2:235007141-235007163 AGGGAGTGGAGGCAGTTGAGTGG + Intronic
948272682 2:236686565-236686587 GGGGAGTGGGGGTAGATAATGGG - Intergenic
948775196 2:240284007-240284029 GGGCAGTGGGGATGGTTAATGGG + Intergenic
1169514095 20:6297486-6297508 GGGGAATGGTGGTTGTCAAGGGG - Intergenic
1169727628 20:8753305-8753327 GGGGAGAGGAGGTTATTGAGGGG - Intronic
1169940615 20:10933315-10933337 GGGGTGGGGGGGTGGTAAAGGGG + Intergenic
1170210748 20:13844171-13844193 GAGGATGGGAGGTGGTTGAGAGG + Intergenic
1170958371 20:21002547-21002569 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1171260556 20:23728205-23728227 GGGAAGTGGAGGTGGTGAGCAGG + Intergenic
1171269671 20:23804054-23804076 GGGAAGTGGAGGTGGTGAGCAGG + Intergenic
1171773936 20:29348725-29348747 GGTGAATGGATGTGGTAAAGTGG - Intergenic
1171815943 20:29786278-29786300 GGTGAATGGATGTGGTAAAGTGG - Intergenic
1171896890 20:30816062-30816084 GGGGCGCGGGGGTGGTCAAGGGG + Intergenic
1172519751 20:35559091-35559113 GGGAGGTGGGGGTGGTCAAGGGG - Intergenic
1172800118 20:37570174-37570196 GGGAAGTGAAGTTGGTTAATGGG - Intergenic
1172938909 20:38641267-38641289 GGGGAGAGGAGGTAGGTAGGAGG - Intronic
1173159050 20:40638962-40638984 GGGGAGAGGAGGTGGTAAAGGGG - Intergenic
1173324449 20:42019876-42019898 TGGAAGTGGTGGTGGTTAATGGG + Intergenic
1173882624 20:46428246-46428268 GGGGAGTGAGGATGGTTAATGGG + Intronic
1174399807 20:50269967-50269989 GGGGAGGGGAGGTGGGGAGGGGG - Intergenic
1174682522 20:52422617-52422639 GGGAGGTGGAGATGGTTAATGGG - Intergenic
1174691408 20:52510254-52510276 GGGGTGTGGGGGTGGTGAGGAGG - Intergenic
1175174953 20:57105847-57105869 GGGGAGTGGGGGTGGGAAATGGG + Intergenic
1175668708 20:60882642-60882664 GGGAAGTGGTGGTGGCTGAGGGG - Intergenic
1175747515 20:61468664-61468686 GGGGAGTGGGGATGGTTAATGGG - Intronic
1177581682 21:23031369-23031391 GGGGGGTGGGGGTGGTGTAGAGG - Intergenic
1177621021 21:23593275-23593297 GTGGATTGGAGGTGGATAGGTGG + Intergenic
1177712420 21:24796211-24796233 GGGGGATGGGGATGGTTAAGGGG - Intergenic
1177824420 21:26066462-26066484 GGGGAGTGGAGGTGGGGGAATGG - Intronic
1177824429 21:26066483-26066505 GGGGAGTGGAGGTGGGGGAATGG - Intronic
1178206898 21:30478816-30478838 GGGGACTGGGGCTGGTTAATAGG - Intergenic
1178211771 21:30542915-30542937 GAGGAGTAGGGGTGGTTAATGGG - Intronic
1179901465 21:44396546-44396568 GGGGTGTGGAGGCTGTGAAGGGG + Intronic
1180486977 22:15810598-15810620 GGGAAGTGGGGATGGTTAATAGG + Intergenic
1180894002 22:19314558-19314580 GGGGAGTGGGAATGGTTAATGGG + Intergenic
1181051087 22:20238624-20238646 GTGGAGTCGGGGTGGTTGAGAGG + Intergenic
1181256436 22:21565928-21565950 GGGGAATGGAGGTGGGTAAGAGG - Intronic
1181328274 22:22068395-22068417 GGGGAATGGAGGTGGCAGAGTGG + Intergenic
1182361588 22:29749587-29749609 AGGGAGTGGAGGAAGCTAAGTGG - Intronic
1182422423 22:30254870-30254892 GTGGAGGGGAGGAGGCTAAGTGG + Intergenic
1183150081 22:36029998-36030020 TGGGAGTGGAGGTGGTGGAATGG - Intergenic
1183168910 22:36170157-36170179 GCCGGGTGGAGGTGGCTAAGTGG - Intergenic
1183424652 22:37733038-37733060 GGGGAGTAGAGGCGGTTGGGTGG - Intronic
1183504657 22:38202409-38202431 GGGGAGTGGGGGTGGAGACGGGG + Intronic
1183700108 22:39446292-39446314 GGTGAGTAGAGGAGGATAAGCGG + Intergenic
1184421337 22:44384488-44384510 TGGGAGTGGGGGTGGGAAAGGGG + Intergenic
1184421660 22:44385838-44385860 GGGGACTGGAGGTCATTCAGGGG - Intergenic
1184703343 22:46192994-46193016 GGGCAGTGAAGATGGTTAACAGG + Intronic
1184946982 22:47810791-47810813 GGGGAGTGGAGGAGGGAAAAGGG - Intergenic
1185019047 22:48362895-48362917 GGGGAGAGGCGGTGGGAAAGGGG + Intergenic
1185255530 22:49828693-49828715 CGGGAGTGGAGGTCCCTAAGAGG + Intergenic
1185404947 22:50642428-50642450 GGGGAGTTGAGCTGCTTCAGCGG + Intergenic
949434422 3:4013068-4013090 GGGGAGGGGAGGTGGGGAAATGG + Intronic
949438392 3:4053624-4053646 GGGCAGTGGAGGTTCTTTAGGGG - Intronic
949549890 3:5104127-5104149 GGGGGGAGGAGGAGGTTAGGGGG - Intergenic
950002093 3:9664778-9664800 GAGGAGTGGGGATGGTTAATGGG + Intronic
950395290 3:12729390-12729412 GGGGTGAGGAGGAGGTTATGTGG - Intergenic
950442585 3:13018657-13018679 GGGGCGGGGAGCTGGTTAAAGGG + Intronic
950447516 3:13046832-13046854 TGGCAGTGGAGGTGGCTTAGAGG - Intronic
950800148 3:15544202-15544224 GGGCAGTGGGGATGGTTAATGGG - Intergenic
951028399 3:17853912-17853934 GGGGAGTAGAGATGGTTAATGGG - Intronic
951128493 3:19012794-19012816 GGGGAGTGGATGTGAAGAAGGGG - Intergenic
951425524 3:22540162-22540184 GGGAAGTGGGGATGGTTAAGGGG + Intergenic
951492293 3:23284990-23285012 GGGGAGTGGAGATGGTTAACAGG - Intronic
952516985 3:34114631-34114653 GGGGAGTGTGGATGGTTAATGGG - Intergenic
952860907 3:37811564-37811586 GGGGAGGGGAGGAGGGTGAGAGG - Intronic
953285240 3:41600177-41600199 GAGGAGTGGTGGTGGATAGGTGG - Intronic
953299811 3:41762259-41762281 GGAGAGTGGGGGTGGTTAATGGG - Intronic
953316940 3:41936789-41936811 GGGGAGTGGGGATGGTTAATGGG + Intronic
953549317 3:43888846-43888868 GGAGAGTGGGGATGGTTAAGGGG + Intergenic
953629981 3:44605868-44605890 GGGTAGTGGGGATGGTTAATGGG + Intronic
954478463 3:50772321-50772343 GGGAGGTGGAGATGGTTAATAGG + Intronic
954766776 3:52924734-52924756 AGAGAGTGGAGGTTGCTAAGAGG + Intronic
954938906 3:54353124-54353146 GGGAAGTGGGGATGGTTAATGGG - Intronic
955044922 3:55350709-55350731 GTGGAGTGGAGGATGTTAGGAGG - Intergenic
955108844 3:55927719-55927741 GGGGAGTGGGGATGGTTAACTGG - Intronic
955292784 3:57707830-57707852 GGGAAGTGGGGATGGTTAATGGG + Intergenic
955481057 3:59390944-59390966 GGGAGGTGGAGATGGTTAATAGG - Intergenic
955833069 3:63025457-63025479 GGAGAGTGGAGGTAGTTAACTGG - Intergenic
956472349 3:69580350-69580372 GGGGAGAGGAGGTGGCATAGAGG + Intergenic
956967362 3:74477605-74477627 GGGAGGTGGAGATGGTTAATGGG + Intronic
957124601 3:76142678-76142700 GGCTAGTGGAGATGGTTAATGGG + Intronic
957463021 3:80547093-80547115 GTGGAGTGGGGATGGTTAATGGG - Intergenic
957917009 3:86698236-86698258 GGGAAGTGGGGATGGTTAAAGGG + Intergenic
959546881 3:107606910-107606932 GGGAAGTGGGGATGGTTAATGGG - Intronic
959964425 3:112337033-112337055 GGGGAGTGGCGGGGGGTGAGGGG + Intronic
960235507 3:115277553-115277575 AGGCAGTGGAGATGGTTAATGGG - Intergenic
960641449 3:119827844-119827866 GGGAAGTGGGGATGGTTAATGGG + Intronic
960798568 3:121514473-121514495 GGGGAGTGGAAGGGGTGATGAGG - Intronic
961384228 3:126515550-126515572 GGGGAGTGGAAGGGGGTAGGTGG - Intronic
961411665 3:126726728-126726750 GTGGGCTGGAGGTGGTTCAGAGG + Intronic
961481516 3:127183751-127183773 GGGGAGGGGAGGTGGAGGAGGGG - Intergenic
961598010 3:128034691-128034713 GGGGAATGAAGGTGGTACAGAGG + Intergenic
962372120 3:134829336-134829358 TGGGGGTGGGGGTGGTTGAGTGG + Intronic
962468611 3:135684905-135684927 GGGGAGTGGGGATGCTTAATGGG + Intergenic
962484478 3:135829026-135829048 GGAGAGTGGGGATGGTTAATGGG + Intergenic
962870177 3:139482042-139482064 GGGGAGTGGGGATAGTTAATGGG - Intergenic
963204120 3:142615086-142615108 GTAGAGTGGGGGTAGTTAAGAGG + Intronic
963260765 3:143188934-143188956 GGGAGGTGGTGGTGGTAAAGGGG - Intergenic
963524845 3:146404822-146404844 GGGGGGGGGTGGTGGTTAACTGG + Intronic
964038768 3:152232210-152232232 GGGAAGTGGGGATGGTTAATGGG + Intergenic
964267477 3:154915101-154915123 GGAGAGTGAAGATGGTTAATGGG + Intergenic
964376297 3:156052055-156052077 GGGCAGGGGAGGTGGTGCAGAGG - Intronic
964643285 3:158932130-158932152 GGAGGGTAGAGGTGGTTCAGTGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965078918 3:164012861-164012883 TAGGAGTGGAGGTGGTCATGGGG - Intergenic
965193463 3:165562035-165562057 GGGGAGTGGGGATGGTTTATGGG - Intergenic
965590237 3:170356152-170356174 GGGGAGTGGTGGGGATTGAGAGG + Intergenic
965735935 3:171820966-171820988 AGGGAGTGGAGGAGGGTAAAAGG + Intergenic
966268008 3:178069986-178070008 GGGAAGTGGGGATGGTTAATAGG + Intergenic
966280056 3:178215392-178215414 GGGTGGTGGAGATGGTTAATGGG + Intergenic
966402372 3:179561433-179561455 GGGGAGGGGAGGTGGGGAAAAGG - Intergenic
966464139 3:180210932-180210954 GGGGAGTGGGGATGGTTAACAGG + Intergenic
966632107 3:182088303-182088325 GGAGAGTGGAGATGGTTAATGGG + Intergenic
966803659 3:183788270-183788292 AGGGAGTGGGGATGGTTAATGGG - Intronic
966973894 3:185068914-185068936 GGTGAGTGGAGGTGGGGAAAGGG + Intergenic
967085715 3:186093387-186093409 GGGAAGGGGAGGTGGTTTAAAGG + Intronic
967289101 3:187902065-187902087 GTGGAGTGGCGGCGGTGAAGTGG - Intergenic
967553811 3:190831463-190831485 GGGGAATGGAGGCGGTGGAGGGG - Intergenic
968018801 3:195365145-195365167 GGGACGTGGAGGTGGTTAATGGG + Intronic
970034315 4:11715364-11715386 GGGAAGTGGAGGTGCTTAATGGG - Intergenic
970922814 4:21415076-21415098 GGGGAATGGGGATGGTTAATGGG - Intronic
972259048 4:37389620-37389642 TGGTAGTGGCGGTGGTGAAGGGG + Intronic
972871518 4:43305462-43305484 TGGAAGTGGGGGTGGTTAATGGG + Intergenic
974069933 4:57114202-57114224 GGGGTGGGGCGGTGATTAAGGGG + Intergenic
975080039 4:70266070-70266092 GGGATGTGGGGATGGTTAAGGGG + Intergenic
975537608 4:75468614-75468636 GAGGAATAGAGGGGGTTAAGAGG - Intergenic
975894399 4:79070035-79070057 GGGTAGAGGAGGTGGTGAAGAGG + Intergenic
976117984 4:81748761-81748783 TGGGGGTGGAGGTGGGGAAGGGG - Intronic
976128956 4:81863799-81863821 GGGAAGTGAAGGTGGTTAATGGG + Intronic
976151431 4:82096369-82096391 GGGGAGTGGGAGGGGTGAAGAGG + Intergenic
976922467 4:90456476-90456498 GGGGACTGGAGTTAGTTCAGAGG + Intronic
977736142 4:100418516-100418538 GGGAAGTGGAGATGGTTAATGGG - Intronic
977879796 4:102191149-102191171 GGGTAGGGGAGGTGGTTACTAGG - Intergenic
977937603 4:102825748-102825770 GGAGAGTGGGGGTGGATAAGGGG - Intronic
978062846 4:104359345-104359367 GGGAAGTGGGGTTGGTTAATGGG + Intergenic
978244603 4:106557809-106557831 GGGGAGTGGAAATGGTTAATGGG + Intergenic
978285602 4:107073455-107073477 GGGGAGTGGTGGTGGGGAGGGGG - Intronic
978399372 4:108314551-108314573 GGGGAGTGGGGCTGGAGAAGAGG - Intergenic
978448391 4:108802796-108802818 AGGGAGTGGAGGTGGTTGTTAGG + Intergenic
978587526 4:110289720-110289742 GGGGGGTGGAACTGGTTAAAAGG + Intergenic
978820875 4:112964292-112964314 GGGAAGTGGGGATGGTTAATGGG - Intronic
979041508 4:115803193-115803215 ACTCAGTGGAGGTGGTTAAGGGG + Intergenic
979129264 4:117019988-117020010 GGGGAGTGGGGATGGTTAATGGG + Intergenic
980190914 4:129523894-129523916 GGGGAGAGTAGGTGGGGAAGAGG + Intergenic
980443670 4:132880448-132880470 GGAAAGTGGAGATGGTTAATGGG + Intergenic
981172105 4:141636778-141636800 GGGGAGTGGTGGTGGTTGAAAGG + Exonic
981287295 4:143033247-143033269 GGGAAGTGGGGATGGTTAATGGG + Intergenic
981579525 4:146237832-146237854 GGGGAGTGGAAATGGTAAGGAGG + Intergenic
981641510 4:146949197-146949219 TGGGAGTGGGGATGGTTAAAGGG - Intergenic
982215992 4:153082931-153082953 GGGGAGAGAAGGGGGTGAAGGGG + Intergenic
983154056 4:164322442-164322464 GGGAGGTGGGGGTGGTTAATTGG + Intronic
983580174 4:169301647-169301669 GGGAAGTGGAGATAGTTAATGGG + Intergenic
983586604 4:169362324-169362346 TGGGGGTGGGGGTGGTTGAGGGG + Intergenic
984211831 4:176859340-176859362 GGGGAGTGGAGGAGTCCAAGAGG + Intergenic
986407271 5:7438547-7438569 GGGGTGTGGCTGTGGTTTAGGGG + Intronic
986630667 5:9769039-9769061 GGGAAGTGGAGCTAGTTAATGGG - Intergenic
986717400 5:10533895-10533917 GGGGCGTGGAGGTGGGTGAGTGG + Intergenic
986884757 5:12219785-12219807 GGGAAGTGGAGATGGTTAATGGG - Intergenic
987267419 5:16271308-16271330 GGGGAGTGGAGATGGCCAAGAGG + Intergenic
987400639 5:17472503-17472525 GGGAAGTGGGGATGGTTAATAGG + Intergenic
987496056 5:18646253-18646275 GGGTAGTGGAGATGGCTAATAGG - Intergenic
987608372 5:20169002-20169024 GGGAAGTGGGGATGGTTAATGGG + Intronic
987612284 5:20221485-20221507 GGGGAGTGGCGATGGTTATTGGG + Intronic
989156162 5:38346955-38346977 GTGGAGTGGAGGTGGGTGGGAGG + Intronic
989316496 5:40086137-40086159 GGGGATTGGGGATGGTTAATGGG + Intergenic
990004240 5:50926416-50926438 GGGTAGTGGATGGGGGTAAGTGG + Intergenic
990330957 5:54724893-54724915 GGGGAGTTAAGCTGGTCAAGGGG - Intergenic
990362032 5:55030358-55030380 GGGGAGTGGTGATGGTCGAGAGG - Intronic
990779279 5:59340649-59340671 TGGGAGTGGAGATGGTTAATGGG - Intronic
990868964 5:60410123-60410145 TGGGAGTCCAGGTGTTTAAGGGG + Intronic
990921108 5:60968825-60968847 GGGAAGTGGAGATGGTTAAGTGG - Intronic
992260208 5:74962187-74962209 GGGGACTGGGGATGGTTAAAGGG + Intergenic
992365190 5:76083512-76083534 GGTGAGTGGGGGAGGTGAAGCGG + Exonic
993170664 5:84415158-84415180 GGGGAGTGGAAATGGTTAATGGG - Intergenic
994389933 5:99180469-99180491 GGGGATGGGAGGGGGTGAAGGGG - Intergenic
994562087 5:101387651-101387673 GGGGGGTGTTGGTGGTTGAGTGG - Intergenic
994671612 5:102768462-102768484 GGGGAGTTGGGATGGTTAATGGG - Intronic
994845210 5:104980201-104980223 GGGAAGTGGGGATGGTTAATGGG - Intergenic
994893103 5:105664735-105664757 CGGAGGTGGAGGTGGTTAATAGG - Intergenic
994967016 5:106685618-106685640 GGGGAGTGGGGATGGTTAATGGG + Intergenic
995267846 5:110185495-110185517 AGGAAGTGGAGATGGTTAATGGG - Intergenic
995289549 5:110435572-110435594 GGGGAGTGGGGATGATTAATGGG - Intronic
996156430 5:120108413-120108435 GAGGGGTGGGGGTGGGTAAGAGG - Intergenic
996210297 5:120799781-120799803 GGGAAGTGGGGTTGGTTAATGGG + Intergenic
996372690 5:122770054-122770076 TAGGAGTGGAGGTGGATAATTGG - Intergenic
996393371 5:122987617-122987639 TGGGTTTGGAGGTGGTTCAGGGG + Intronic
996422533 5:123278240-123278262 GGGGAAAGCAGGTGGTTCAGGGG + Intergenic
996484773 5:124019537-124019559 GGGAAGTGGAGATGGTTAGTGGG - Intergenic
997085480 5:130792569-130792591 GTGGAGTGGGTATGGTTAAGGGG + Intergenic
997105456 5:131013751-131013773 GAGGAGTGGGGATGGTTAATGGG + Intergenic
997174701 5:131763034-131763056 GGGGAGTGAGGATGGTTAATGGG + Intronic
999129836 5:149273802-149273824 GGGGAGTGGGGGTGGTGGAGAGG - Intronic
999383532 5:151138628-151138650 GGGGTGGGGATGTGGTTAATGGG - Intronic
999455297 5:151710695-151710717 GGGAAGTGGAGATGGTTAACGGG - Intergenic
999545989 5:152629210-152629232 GGGAAGTGGGGATGGTTAACGGG - Intergenic
999585283 5:153082931-153082953 GGGGAATGGTGGTGGTAGAGAGG - Intergenic
1000400558 5:160822889-160822911 GGGTAGTGGAGATGGCTAATGGG + Intronic
1000531913 5:162433318-162433340 GGGTAGTAGAGATGGTTAATGGG - Intergenic
1001095682 5:168773775-168773797 GCAGGGTGGAGGGGGTTAAGCGG + Intronic
1001761643 5:174212609-174212631 GTGGAGAGGAGATGGCTAAGTGG - Intronic
1002643835 5:180643442-180643464 GGGGAGGGGAGGAGGGAAAGTGG - Intronic
1004153392 6:13143155-13143177 GGGAAGTGGAGATGGTTAATGGG + Intronic
1004879879 6:19996775-19996797 GGTGAGGGGTGGTGGTGAAGTGG - Intergenic
1005280338 6:24267173-24267195 GAGGAGTGGAGATGGTTAATGGG + Intronic
1006071549 6:31500568-31500590 GGGGAGTGCGGATGGTTAATGGG - Intronic
1006099740 6:31679219-31679241 GGGGAATGGAAGTGGTTGAGGGG + Exonic
1006131161 6:31870327-31870349 TGGGAGTGGTGGTGGCTGAGTGG - Intronic
1006519283 6:34562177-34562199 ACGGGGTGGAGGTGGTAAAGAGG - Intergenic
1007355600 6:41313563-41313585 AGAAAGTGGAGGTGGTTTAGGGG + Intergenic
1007437275 6:41823815-41823837 GGGCAGTGGAGGTGGTGGGGGGG + Intronic
1007478207 6:42133235-42133257 GGGGCGAGGAGGAGGTGAAGGGG + Intronic
1007733537 6:43966232-43966254 GGAGAGTGGAGGGGGCTGAGTGG - Intergenic
1007847665 6:44773584-44773606 GAGGAGTGGAGATGGTTAATGGG - Intergenic
1008065766 6:47046337-47046359 GGGGAGTGGGGATGGTTAATGGG - Intergenic
1008190797 6:48454474-48454496 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1008649108 6:53545147-53545169 GGGGAGAGGAGGCGGTGCAGCGG + Intronic
1009576182 6:65464627-65464649 GGGGAGAGGAGATGGTTTAGAGG - Intronic
1009602630 6:65821867-65821889 GGGAAGTGGGGATGGTTAAATGG + Intergenic
1009616557 6:66015748-66015770 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1009969525 6:70612304-70612326 GTGGTGTGGAGGTGGGTAGGGGG - Intergenic
1010146332 6:72673607-72673629 GAGGAGTGGAGGAGGCGAAGAGG + Intronic
1010156820 6:72804290-72804312 GGGTAGTGGGGATGGTTAATGGG - Intronic
1010263448 6:73842198-73842220 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1010434313 6:75812572-75812594 GGGGAGTAGGGATGGTTAATGGG - Intronic
1010514607 6:76758246-76758268 AGGGAGTGGTGATGGTTAAAGGG + Intergenic
1010535295 6:77020469-77020491 GGGGAGTTGAAGAGTTTAAGAGG + Intergenic
1010692467 6:78926664-78926686 GGGAGGTGGGGATGGTTAAGGGG - Intronic
1010839369 6:80630021-80630043 GGGAAGTGGGGATGGTTAATAGG + Intergenic
1011306041 6:85927972-85927994 GGAGAGTGGGGATGGTTAATGGG - Intergenic
1011442248 6:87399401-87399423 AGGTAGTGGAGGTGGGTATGGGG - Intronic
1011532164 6:88334608-88334630 GGGAAGTAGAGATGGTTAATGGG + Intergenic
1011640640 6:89413085-89413107 GGGGAGTGGCGGTGGTGGGGGGG + Intergenic
1011743375 6:90386081-90386103 AGGGGGTGGAGGTGGGAAAGGGG - Intergenic
1012225436 6:96698272-96698294 GGGAAGTGGAGATGGGTAATGGG + Intergenic
1012544649 6:100404096-100404118 GGTGTGTGGAGGTGGTTTACGGG - Intronic
1012782861 6:103585284-103585306 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1013562494 6:111319529-111319551 GGGAAGTGGAGATGGTTAATGGG + Intronic
1013793016 6:113857590-113857612 GGGGGGTGGGGGTGGTGGAGAGG - Exonic
1014004629 6:116403971-116403993 AGGGAGTGGGGGTGGTGAAAAGG + Intronic
1014012758 6:116495139-116495161 GAGGAGTGGAGATGGTTAATGGG - Intronic
1014050992 6:116954256-116954278 GGGAGGTGGAGATGGTTAATGGG - Intergenic
1014485113 6:121989667-121989689 AGGAAGTGGAGATGGTTAATGGG - Intergenic
1014693039 6:124585331-124585353 GGTTAGTGGAGGTGGTTAATAGG + Intronic
1015199935 6:130568126-130568148 GGGAGGTGGAGATGGTTAATGGG - Intergenic
1015325768 6:131921709-131921731 GGGAGGTGGAGATGGTTAATGGG + Intergenic
1015672453 6:135705470-135705492 GGGGAAGGGAGGTGGCAAAGAGG + Intergenic
1015675883 6:135748174-135748196 GTGGAGTGGGGATGGTTAATGGG - Intergenic
1015809180 6:137144290-137144312 GGGGGGTGGAGGAGAATAAGAGG - Exonic
1016151884 6:140750729-140750751 TGGGAGTGGAGTTGGAAAAGGGG + Intergenic
1016185105 6:141189074-141189096 GGGAGGTGGAGATGGTTAACGGG - Intergenic
1016405200 6:143722736-143722758 GGGGAGGAGGGATGGTTAAGGGG - Intronic
1016567267 6:145470044-145470066 GGGGAATGGGGATGGTTAATGGG + Intergenic
1017396702 6:154008793-154008815 GGGAAGTGGAGATGGTTAATGGG + Intergenic
1018917083 6:168140199-168140221 GGGGAGTTGGGATGGTTAATTGG - Intergenic
1019272658 7:159169-159191 GGGGAGGGAAGGTGGTCTAGTGG - Intergenic
1019613457 7:1948310-1948332 GGGGGGTGGAGGGGGTTCATGGG - Intronic
1020002279 7:4762717-4762739 GGGGAGAGGAGGTGGTGCCGAGG - Exonic
1020394130 7:7694501-7694523 GGGGAATGGAGATGGTTAATGGG - Intronic
1020483056 7:8685797-8685819 GGGAAGTGGGGATGGTTAATAGG + Intronic
1020503292 7:8951281-8951303 GGGAGGTGGAGATGGTTAATCGG + Intergenic
1021451371 7:20785822-20785844 GGGGAGGGGAGGTGGGCAAAGGG + Intronic
1021497967 7:21297197-21297219 GGGGGGTGGCGGTGGGTAATAGG + Intergenic
1022357974 7:29633658-29633680 GGGAAGTGGACATGGTTAATGGG + Intergenic
1022368238 7:29746281-29746303 GGGAAGTGGACATGGTTAATGGG + Intergenic
1022385290 7:29893281-29893303 GGTGAGGGGAGGTGGCTAAAGGG + Intronic
1025055272 7:55760025-55760047 GGGGGGAGCAGGTGGTTCAGTGG - Intergenic
1026294957 7:69043155-69043177 GGGAAGTGGGGATGGTTAACGGG + Intergenic
1027288802 7:76678975-76678997 GGTGAGTGGAGGTGGGTGGGTGG - Intergenic
1027318584 7:76998778-76998800 GGTGTGTGGAGGTGGGTATGGGG + Intergenic
1028267259 7:88741712-88741734 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1028646230 7:93099810-93099832 GGGGTGTGGGGGTGGTGAAAGGG - Exonic
1029247701 7:99214638-99214660 GGGGAGGGGAGGTAGGGAAGGGG + Intergenic
1029338732 7:99925033-99925055 GGAAAGTGGAGATGGTTAATGGG + Intronic
1029745158 7:102512437-102512459 GGAGAGAGGTGGGGGTTAAGAGG + Intronic
1029763150 7:102611598-102611620 GGAGAGAGGTGGGGGTTAAGAGG + Intronic
1029989086 7:104946601-104946623 GGGTGGTGGTGGTGGTGAAGAGG - Intergenic
1030086781 7:105822537-105822559 GGGGCATGGAGGTGGCTAACTGG + Intronic
1032001712 7:128270069-128270091 GGGGAGGGGTGATGGTTAATAGG + Intergenic
1032185918 7:129726034-129726056 CGTAAGTGGAGGTGGGTAAGGGG - Intronic
1032716325 7:134512023-134512045 GGGGAGTGGAGATGCTTCTGAGG - Intergenic
1033648376 7:143321926-143321948 TGGGAGTGGAAGTGGATCAGGGG + Intronic
1034199312 7:149272860-149272882 GGGAAGTAGAGATGGTTAATGGG - Intronic
1034963716 7:155378352-155378374 GTGGGGTGGGGGTGGTGAAGGGG - Intergenic
1036751332 8:11445313-11445335 GGTGGGTGGAGGTGGTGAGGGGG - Intronic
1036782425 8:11658829-11658851 TGGGAGTGGCCGTGGTTGAGTGG - Intergenic
1036791909 8:11726617-11726639 GGGGAGTGGGGGCGGTGCAGAGG + Intronic
1036936308 8:13005312-13005334 GGGAAGTGGAGATTGTTAATGGG + Intronic
1037583720 8:20262085-20262107 GGGGAATGGATGGGGTAAAGAGG - Intronic
1037701028 8:21273925-21273947 AGGGAGAGTAGGAGGTTAAGAGG + Intergenic
1037858507 8:22388551-22388573 GGGGAGGGGCGGTGATGAAGTGG + Intronic
1037885904 8:22596216-22596238 TAGGAGTGGAGGGGGATAAGTGG + Intronic
1037902999 8:22698853-22698875 GGGTGGTGGATGTGGGTAAGAGG + Intergenic
1038197911 8:25385005-25385027 TGGGAGTGGAGCAGGTAAAGGGG + Intronic
1038205423 8:25459836-25459858 AGGAAGTGGAGATGGTTAATAGG + Intronic
1038315525 8:26481436-26481458 AGTGAGTGGAGGTGGTGCAGGGG - Intronic
1038885963 8:31663421-31663443 GGGCAGTGCAGGTGGTTTGGAGG - Intronic
1039550467 8:38439599-38439621 TGGGAGAGGACGTGGTTGAGAGG - Intronic
1041616449 8:59912923-59912945 GGGGAGAGGAGATGGTTAATGGG + Intergenic
1042646993 8:70997960-70997982 GGGCAGAGGAGGTGGGTAGGGGG - Intergenic
1042933763 8:74038315-74038337 GAGGAGTGGGGTTGGTTAATGGG - Intergenic
1043168054 8:76929163-76929185 GGGGAGTGGAGGTAGGAAATGGG - Intergenic
1043412992 8:80019015-80019037 GGGGAGTGGGGATGGTTAATAGG - Intronic
1043631775 8:82344322-82344344 GGAGAGTAGAGATGGTTAATGGG - Intergenic
1044468635 8:92538685-92538707 GGGTGGTGGAGATGGTTAATGGG + Intergenic
1044957552 8:97496995-97497017 GAGAAGTGGAGATGGTTAATGGG + Intergenic
1045350645 8:101335523-101335545 TGGGAGTGGGGATGGTAAAGAGG - Intergenic
1045559665 8:103248802-103248824 GCCAAGTGGAGGTTGTTAAGGGG - Intergenic
1045573103 8:103390179-103390201 GGAGAGTGGGGATGGTTAATGGG + Intergenic
1045801092 8:106102030-106102052 AGGGAGTGCAGATGGTTAATAGG + Intergenic
1046360156 8:113142617-113142639 GGGAAGTAGAGATGGTTAATGGG + Intronic
1047076543 8:121410824-121410846 GTGGAGTGGGGATGGTTAATGGG - Intergenic
1047136880 8:122089362-122089384 AGGGAGTGGAGGAGGGTAAAGGG + Intergenic
1047349776 8:124062674-124062696 GGGGAGTTGAGGTAGTCAATGGG - Intronic
1047430170 8:124784341-124784363 GGGAAGTGGAGATGGTTACTAGG - Intergenic
1048184413 8:132226436-132226458 GGGGAGTGGAGGCAGGTAAAGGG + Intronic
1048272547 8:133041142-133041164 GGGGAGATGATGTGGTCAAGGGG + Intronic
1049035540 8:140072620-140072642 GAGGAGCGGTGGTGGTGAAGAGG + Intronic
1049231510 8:141487223-141487245 GGGAAATGGAGATGGTTAATGGG - Intergenic
1049283699 8:141763274-141763296 GGGGAGGTCAGGAGGTTAAGAGG + Intergenic
1050340087 9:4628123-4628145 GGGGAGTGGGGATGGTTAAAGGG + Intronic
1050759489 9:9049533-9049555 GGGATGTGGAGGTTGCTAAGGGG + Intronic
1050829263 9:9990453-9990475 CGGGAGGGGAGGTGGTAAGGAGG - Intronic
1051220459 9:14843287-14843309 GGGGAGTGGAGAGGGGTGAGTGG - Intronic
1051432721 9:16996607-16996629 GGGAAGTGGAGATTGTTAATGGG + Intergenic
1051620245 9:19043422-19043444 GGGAGGTGGAGATGGTTAATAGG + Intronic
1051687107 9:19669297-19669319 GGGGAGTGGTGGTGGGTTATGGG + Intronic
1051718078 9:20006339-20006361 GGGGAGGGGGGATGGTTAATGGG + Intergenic
1051724822 9:20078302-20078324 GGGGAGTGGGGGTGGGGAAGTGG - Intergenic
1051916854 9:22218417-22218439 GAGAAGTGGGGGTGGTTAACTGG + Intergenic
1052094935 9:24372365-24372387 AGGGAGTAGAGTTGGTTAATAGG + Intergenic
1052586391 9:30433740-30433762 TGGAAGTGGGGATGGTTAAGGGG + Intergenic
1053044403 9:34902815-34902837 GGGGAGGGGAGGTGGTTAATAGG + Intergenic
1053188857 9:36042811-36042833 TGGGAGTGGATGTGGTGAAAAGG - Intronic
1055243280 9:74210754-74210776 GGGCAGTGGAGATGGTTAATGGG - Intergenic
1055338120 9:75253603-75253625 GGGAGGTGGAGGTGGTTAATAGG - Intergenic
1055387650 9:75780527-75780549 GGAAAGTGGGGATGGTTAAGGGG + Intergenic
1055579521 9:77692883-77692905 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1055581492 9:77711177-77711199 GGGGAGGGGAGGAGGGGAAGGGG - Intergenic
1055876790 9:80953163-80953185 CAGGAGTGGAGGTGATGAAGAGG - Intergenic
1056292442 9:85157296-85157318 GGGGAGTGGGGAGGGTTTAGGGG - Intergenic
1056562653 9:87745876-87745898 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1056844656 9:90026673-90026695 GGGGAGTTGAGGTGAGGAAGGGG + Intergenic
1056900740 9:90597130-90597152 GATGAGTGGAGGTTGTTAGGTGG + Intergenic
1057181591 9:93033526-93033548 GAGGAGTGGAGGAGGAAAAGAGG - Intronic
1057489359 9:95509251-95509273 GGGGAGGGGAGGGGGTGGAGGGG + Intronic
1057885918 9:98829592-98829614 GGGGAGTGGGGATGGTTAATGGG - Intronic
1057889451 9:98858048-98858070 GTGAAGTGAAGTTGGTTAAGGGG - Intergenic
1058050559 9:100402042-100402064 GGGGATGGGAGGTGGGGAAGGGG - Intergenic
1059074908 9:111182375-111182397 GGGAAGTGGGGATGGTTAATGGG + Intergenic
1059796418 9:117701927-117701949 AGGTAGAGGAGGTGGTTCAGAGG + Intergenic
1060049986 9:120371687-120371709 GGGCAGTGGAGGAGGTTAGAGGG + Intergenic
1060374371 9:123105460-123105482 AGGGGGTTGAGGTGGTGAAGAGG - Intergenic
1061050204 9:128190920-128190942 GGGGAGTGGCGGTGGATGGGAGG - Intronic
1061465787 9:130778439-130778461 GGGGTGAGGAGGTGGAGAAGTGG + Intronic
1061542004 9:131282699-131282721 GGGGAGTGGAGGGTGTTGCGGGG - Intergenic
1061861945 9:133472723-133472745 GGGGAGTGGGTGGGGTTGAGGGG + Intronic
1185581365 X:1213232-1213254 GGGGAGGGGAGGTGGGGAGGAGG - Intergenic
1185648411 X:1631394-1631416 GGGTAGAGGAGGTGCTTAAGGGG - Intronic
1186038441 X:5449541-5449563 GGGTAGGGGAGGGGGTTATGTGG - Intergenic
1186058265 X:5674577-5674599 GGGGAGGGGAGGGGGGGAAGAGG + Intergenic
1186122410 X:6377933-6377955 GGGAAGTAGAGATGGTTAATGGG + Intergenic
1186356870 X:8799748-8799770 GGGGAATGGAGGTGGTGGAGAGG - Intronic
1186357194 X:8800863-8800885 GGGGAATGGAGGGGGTGGAGAGG - Intronic
1186376409 X:9006786-9006808 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1186761818 X:12730972-12730994 GGGATGTGGGGGTGGTTAATGGG + Intergenic
1187554929 X:20342651-20342673 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1187625061 X:21102030-21102052 GGGGAGTGGGGATAGTTAATGGG + Intergenic
1188206102 X:27360156-27360178 GGGAAGTGGGGATGGTTAATGGG + Intergenic
1188279354 X:28245684-28245706 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1188349058 X:29104491-29104513 GGGGAGTGGGAGTGGTTAATGGG + Intronic
1188489056 X:30717472-30717494 GGGGATAGGGGGTGGTTATGGGG - Intronic
1188737047 X:33729893-33729915 GGAGAGTGGGGATGGTTAATAGG - Intergenic
1189088840 X:38056083-38056105 GGGAAGTGGAGATGGCTAACAGG - Intronic
1189854012 X:45205085-45205107 GGGAAGTGGGGATGGTTAATGGG - Intergenic
1190024681 X:46912567-46912589 GGGGCGAGGAGGGGATTAAGGGG + Exonic
1190179240 X:48177532-48177554 GGAGAGGGGAGGGGGTGAAGGGG + Intergenic
1190328690 X:49222663-49222685 GTGGAGTCGGGGTGGGTAAGGGG - Intronic
1190492249 X:50993783-50993805 GAGGTGAGGAGGTGGGTAAGGGG + Intergenic
1190853160 X:54266320-54266342 GGGGAGTGGGGAAGGTTAATGGG + Intronic
1191058869 X:56273442-56273464 GGGCAGTGGGGATGGTTAATGGG - Intronic
1191102047 X:56740957-56740979 GGAGAGTGGGGATGGTTAACGGG - Intergenic
1191833228 X:65437273-65437295 GGGGAGTGGGGATGGTTAATGGG - Intronic
1192041381 X:67626189-67626211 GGGGAGTGGGGATGGTTAATGGG - Intronic
1192092159 X:68170991-68171013 GGGGAGTGGAGATGGTTAATAGG + Intronic
1192225975 X:69228248-69228270 GGGGAGTGGGGGTTATAAAGGGG - Intergenic
1192307426 X:69976763-69976785 GGGGAGGGGGGGTGGAAAAGGGG + Intronic
1192308447 X:69988274-69988296 GGAGAGTGGGGATGGTTAATGGG + Intronic
1192363923 X:70455492-70455514 GGGGAGAGGTGATGGCTAAGAGG - Intronic
1192434343 X:71133673-71133695 AGGGACTGAAAGTGGTTAAGGGG + Intronic
1192560166 X:72123068-72123090 GGGGAGTGGAGGCAGTTTCGCGG + Intergenic
1192614613 X:72606834-72606856 TGGGGGTGGAGATGGTTAATGGG - Intronic
1192671261 X:73144410-73144432 GGGAAGTGAAGGTGGTAAATGGG - Intergenic
1193138614 X:78001567-78001589 GGGAAGTGGGGATGGTTAATGGG - Intronic
1193190485 X:78564303-78564325 GGGGAGTGGGGATGATTAACGGG - Intergenic
1193397207 X:80999674-80999696 GGGAAGTGGAGGTAGTTAATGGG + Intergenic
1193592139 X:83402552-83402574 GGGGAGTGGGGATGGTTAGTAGG + Intergenic
1193761562 X:85473188-85473210 GGGAAGTGGAGATGGTTAATGGG + Intergenic
1194225113 X:91246803-91246825 AGGAAGTGGAGATGGTTAATGGG - Intergenic
1194249670 X:91559483-91559505 GGGAAGTGGCGATGGTTAATGGG + Intergenic
1194280917 X:91953070-91953092 GGGAGGTGGGGGTGGTTAATGGG + Intronic
1194371425 X:93077756-93077778 GGGGAGGTGGGGTGGTTAATGGG + Intergenic
1194529115 X:95022176-95022198 GGGAAGTGGTGTTGGTTAGGTGG - Intergenic
1194589749 X:95785211-95785233 GGAAAGTGGAGCTGGTTAATGGG + Intergenic
1194789033 X:98122667-98122689 GGGAAGTGAAGATGGTTAATCGG + Intergenic
1194876776 X:99199806-99199828 GGGAAGTGGAAATGGTTAATGGG - Intergenic
1194902167 X:99525683-99525705 GGGAAGTGGGGATGGTTAATGGG + Intergenic
1195116452 X:101703703-101703725 GGGGAGTGGGGATCATTAAGGGG + Intergenic
1195389866 X:104350451-104350473 GGGGAGTGGGGGTGGTGGGGGGG - Intergenic
1195428224 X:104759919-104759941 GGGAGGTGGAGATGGTTAATGGG - Intronic
1195730414 X:107960924-107960946 GGGAAGTGAAGGTGGTTAATGGG - Intergenic
1195768234 X:108319394-108319416 AGGGAGTGGAGGTAGATAAAGGG + Intronic
1195804771 X:108752223-108752245 GGTGAGTGGGGATGGTTAATGGG - Intergenic
1195856783 X:109340183-109340205 GGGAAGTGGAGATGGTTACTGGG + Intergenic
1196071459 X:111527693-111527715 GGGAGGTGGAGATGGTTAATGGG + Intergenic
1196231734 X:113232144-113232166 GAGAAGTGGAGGTGGTTAATGGG - Intergenic
1197032439 X:121833601-121833623 GGGAAGTGGGGATGGTTAATGGG + Intergenic
1197296888 X:124729938-124729960 GGGGAGTGGGGATGGTTCAGAGG - Intronic
1197577824 X:128241573-128241595 GGGGAGTGAAGATTGTTAATGGG + Intergenic
1197775113 X:130113822-130113844 GGGAAGTGCAGATGGTTAATGGG - Intergenic
1198027841 X:132726015-132726037 GGGTAGTGGAGGGGGGTAGGGGG + Intronic
1198056169 X:132997353-132997375 GGGAGGTGGAGATGGTTAATGGG + Intergenic
1198272713 X:135069548-135069570 GGGAAGTGGAGAGGGTTAACTGG - Intergenic
1198316028 X:135467255-135467277 AGGGAGTGGGGATGGTTAATGGG + Intergenic
1198538348 X:137609033-137609055 GGGAAGTGGAGATTGTTAATGGG + Intergenic
1198632828 X:138660725-138660747 AGGGAGTGGGGATGGTTAATGGG - Intronic
1199111331 X:143938313-143938335 GGGATGTGGAGATGGTTAATGGG + Intergenic
1199189985 X:144959810-144959832 GGGGAGTAGAGATGTTTAATGGG + Intergenic
1200275305 X:154726712-154726734 TGGGAGAGGAGAGGGTTAAGTGG - Intronic
1200383377 X:155864105-155864127 GGGGAGTGGGGATGGCTAATAGG - Intergenic
1200561579 Y:4710110-4710132 AGGAAGTGGAGATGGTTAATGGG - Intergenic
1200568628 Y:4800733-4800755 GGGAAGTGGCGATGGTTAATGGG + Intergenic
1200598509 Y:5177730-5177752 GGGAGGTGGGGGTGGTTAATGGG + Intronic
1200679221 Y:6189634-6189656 GGGGAGGTGGGGTGGTTAATGGG + Intergenic
1200884131 Y:8252227-8252249 GGGGAGTGGGAGTGGTTCACTGG - Intergenic