ID: 1075331391

View in Genome Browser
Species Human (GRCh38)
Location 10:121576764-121576786
Sequence GTCCCTTAGCAGTAAGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075331384_1075331391 15 Left 1075331384 10:121576726-121576748 CCTGTCTCAACAGACAGCTATAC 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1075331391 10:121576764-121576786 GTCCCTTAGCAGTAAGGCTATGG No data
1075331388_1075331391 -9 Left 1075331388 10:121576750-121576772 CCAAGCCTCTCATGGTCCCTTAG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1075331391 10:121576764-121576786 GTCCCTTAGCAGTAAGGCTATGG No data
1075331387_1075331391 -8 Left 1075331387 10:121576749-121576771 CCCAAGCCTCTCATGGTCCCTTA 0: 1
1: 0
2: 0
3: 6
4: 165
Right 1075331391 10:121576764-121576786 GTCCCTTAGCAGTAAGGCTATGG No data
1075331386_1075331391 -7 Left 1075331386 10:121576748-121576770 CCCCAAGCCTCTCATGGTCCCTT 0: 1
1: 0
2: 0
3: 15
4: 237
Right 1075331391 10:121576764-121576786 GTCCCTTAGCAGTAAGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075331391 Original CRISPR GTCCCTTAGCAGTAAGGCTA TGG Intronic
No off target data available for this crispr