ID: 1075333423

View in Genome Browser
Species Human (GRCh38)
Location 10:121591838-121591860
Sequence ATGTGGGTATTGTTGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075333423_1075333429 14 Left 1075333423 10:121591838-121591860 CCTGCTTCCAACAATACCCACAT 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1075333429 10:121591875-121591897 TCTTACACAAAGACTCACTCGGG No data
1075333423_1075333430 15 Left 1075333423 10:121591838-121591860 CCTGCTTCCAACAATACCCACAT 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1075333430 10:121591876-121591898 CTTACACAAAGACTCACTCGGGG No data
1075333423_1075333428 13 Left 1075333423 10:121591838-121591860 CCTGCTTCCAACAATACCCACAT 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1075333428 10:121591874-121591896 TTCTTACACAAAGACTCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075333423 Original CRISPR ATGTGGGTATTGTTGGAAGC AGG (reversed) Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
905292262 1:36930203-36930225 ATGTGGGCCTTCTTGGAGGCTGG + Intronic
907387531 1:54135808-54135830 ATGTGGCTAATGTTGGGAGGCGG + Intronic
909104653 1:71393119-71393141 ATGTGGAAATTATTGGAAACTGG + Intergenic
910973066 1:92876362-92876384 TAGTGGTTTTTGTTGGAAGCTGG - Exonic
916059280 1:161087689-161087711 CTGGGGGTACTGCTGGAAGCTGG + Intronic
916152055 1:161803613-161803635 ATGTTGATAATGATGGAAGCTGG + Intronic
918113017 1:181474674-181474696 ATATGGGTTTTTTTTGAAGCAGG + Intronic
919518964 1:198563599-198563621 ATGTGGCTATTGTTGTTAGGAGG - Intergenic
922058120 1:222061381-222061403 ATGTGGTTCTTGTTGGAAGTGGG + Intergenic
922092036 1:222405020-222405042 ATGTGCGTAATGTTGGAAAGGGG + Intergenic
923221644 1:231899887-231899909 ATGTGTCTATTTTGGGAAGCAGG - Intronic
923561328 1:235044058-235044080 ATGTGAGTATATTTGGAAACAGG + Intergenic
1066864016 10:40371387-40371409 TTGAGGCCATTGTTGGAAGCGGG + Intergenic
1067572584 10:47382328-47382350 ATGATGCTATTGTTGGAACCTGG - Intronic
1067943079 10:50672375-50672397 ATGTGGTTTTTGCAGGAAGCAGG - Intergenic
1068402750 10:56551531-56551553 ATGTAGGGATTGGTGGAAACTGG + Intergenic
1068933982 10:62618445-62618467 CTTCGGGTATTGTTTGAAGCAGG - Intronic
1069846361 10:71374527-71374549 GTGTGTGTGTTGTGGGAAGCAGG + Intergenic
1070529549 10:77324770-77324792 AAGTGGGTTCTGTTGGTAGCTGG + Intronic
1070739198 10:78891549-78891571 TTGTGGGCATTGGTGGGAGCAGG + Intergenic
1070772600 10:79091007-79091029 AGGTGGGGAGTGGTGGAAGCAGG - Intronic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1075333423 10:121591838-121591860 ATGTGGGTATTGTTGGAAGCAGG - Intronic
1076911462 10:133392203-133392225 GTGTGGGTAGTGTTGGGTGCTGG + Intronic
1077598621 11:3556679-3556701 AGGTGGGTGTGGTTGGAGGCAGG - Intergenic
1077620856 11:3721924-3721946 AAGTGGGTGTTGCTGGAGGCTGG - Intronic
1078451982 11:11447216-11447238 ATGAGGGTACTGTTGGAGGATGG - Intronic
1078900778 11:15640506-15640528 ATGCGGCTATTGTTTAAAGCCGG + Intergenic
1082495188 11:53594500-53594522 ATGAGGATATCGTTGGAAACGGG + Intergenic
1084715293 11:70869774-70869796 ATGGTGGTGTTGTTGGAAGATGG + Intronic
1085006770 11:73099207-73099229 GTGTGTTTATTTTTGGAAGCAGG - Intronic
1085078280 11:73611413-73611435 ATGTCACTATTGGTGGAAGCTGG - Intergenic
1085087048 11:73675462-73675484 ATGGGGGTATTGTTGGGGGGTGG - Intergenic
1086076989 11:82865217-82865239 ATCTGGGTTTTCTTGGAGGCGGG - Intronic
1092424769 12:8366027-8366049 AGGTGGGTGTGGTTGAAAGCAGG - Intergenic
1094675700 12:32618246-32618268 ATTTGGTTATTGTTGGTGGCTGG + Intronic
1094878490 12:34681941-34681963 TTGAGGGTTTTGTTGGAAACGGG + Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1097051415 12:56225279-56225301 ATGTGGATATTGGTGGAATGAGG - Intronic
1098328605 12:69328996-69329018 ACGTAGATATTGTTAGAAGCTGG + Intergenic
1100528474 12:95442347-95442369 AGATGGGTATGGGTGGAAGCTGG - Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1103975516 12:124700218-124700240 ATGTGACAATTGTTGGAAACTGG - Intergenic
1105160547 13:17425748-17425770 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
1105164653 13:17490631-17490653 TTGAGGATATCGTTGGAAGCGGG + Intergenic
1105188132 13:17857093-17857115 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1105192172 13:17919824-17919846 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1105196998 13:17994599-17994621 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1106475952 13:30098322-30098344 ATGAGGGGATTGTTGGAGGTTGG - Intergenic
1106795806 13:33204119-33204141 ACGTGGGTACTGTCAGAAGCTGG + Intronic
1107590591 13:41899862-41899884 AAGTGGGTATTGATGTAAGGAGG - Intronic
1108492912 13:50999200-50999222 ATGTGGGGACTTCTGGAAGCTGG - Intergenic
1111990089 13:95107843-95107865 ATGGGAGAATTGTTTGAAGCTGG + Intronic
1112295248 13:98180403-98180425 ATGTGGTTAGTGTTGGAGGTAGG - Intronic
1112870663 13:103966935-103966957 ATGTCAGTAGTGTTGGAAACTGG + Intergenic
1113761024 13:112846715-112846737 CTGTGGGCTTTGTTGGATGCTGG + Intronic
1114000415 14:18234986-18235008 TTGAGGGTCTTGTTGGAAACGGG - Intergenic
1118423020 14:65628419-65628441 ATGTAGGCAATGGTGGAAGCAGG + Intronic
1118445480 14:65847299-65847321 TTGAGGCTATTGTGGGAAGCAGG + Intergenic
1120176729 14:81302199-81302221 AAGTGAGTATTGCTGTAAGCTGG - Intronic
1120727107 14:87956425-87956447 TTGTGTGTGTTGTTGGAAACTGG - Intronic
1125905089 15:43384361-43384383 ATATGGGTATTCTTGGAACATGG + Intronic
1127394834 15:58536265-58536287 ATTTGGGAACTGTTGGTAGCAGG + Intronic
1128790418 15:70429427-70429449 ATGTGGGTATTGCTGTCAGACGG - Intergenic
1130394098 15:83487005-83487027 ATGTGGTTGTATTTGGAAGCAGG - Intronic
1131794951 15:96006884-96006906 AGGTGGGGATTGTTGGAAAATGG - Intergenic
1136951940 16:34731458-34731480 TTGTGGATTTTGTTGGAAACGGG - Intergenic
1142318892 16:89368150-89368172 ATGTTGGAATTGTTGGAATCTGG - Intronic
1145615274 17:25637240-25637262 GTGAGGATTTTGTTGGAAGCGGG + Intergenic
1146973395 17:37091139-37091161 GTCTGAGCATTGTTGGAAGCAGG - Intronic
1154549156 18:15655075-15655097 TTGTGGATTTTGTTGGAAACGGG + Intergenic
1154554757 18:15736747-15736769 TTGTGGATTTTGTTGGAAACGGG + Intergenic
1154564308 18:15873490-15873512 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
1154608148 18:16473350-16473372 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1154626341 18:16723411-16723433 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1154684333 18:17518102-17518124 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1154704597 18:17796150-17796172 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1154722879 18:18046810-18046832 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1154754962 18:18486913-18486935 TTGAGGATTTTGTTGGAAGCTGG + Intergenic
1154787489 18:18933067-18933089 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1154793445 18:19014961-19014983 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1154809017 18:19228770-19228792 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1154809751 18:19238957-19238979 TTGAGGATTTTGTTGGAAGCGGG + Intergenic
1154878652 18:20189547-20189569 ATGAGGATTTCGTTGGAAGCGGG + Intergenic
1155336504 18:24770433-24770455 ATGTGGGTAGGGTAGGAGGCAGG - Intergenic
1156295604 18:35787130-35787152 AAGTGGGTCTTTGTGGAAGCAGG + Intergenic
1156676525 18:39533010-39533032 ACTTGGGTATTGTTGGAGCCTGG - Intergenic
1157444023 18:47731455-47731477 CTGGGGGTACTGTTGGAGGCTGG - Intergenic
1157879112 18:51303292-51303314 AGATGGGTAGTGTTGGAAGAAGG + Intergenic
1158625874 18:59071271-59071293 ATGTGGTTAATGTTTGAAGCTGG + Intergenic
1161670153 19:5602819-5602841 ATGTCTGTATTGGTGGAAGATGG - Intronic
1162188888 19:8929127-8929149 ATGTCTGTTTTGTTGGATGCAGG - Intronic
1163358508 19:16830086-16830108 TTGTGGGGATTCCTGGAAGCAGG + Intronic
1166709097 19:44925719-44925741 ATGTGGTGATGGTGGGAAGCAGG + Intergenic
928518010 2:32062249-32062271 ATGTGGAGATTCTTGGAAGCTGG + Intergenic
928895971 2:36263899-36263921 ATGAGGTTATTGTTGAAATCAGG - Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
931895673 2:66726942-66726964 ATGTGGATATCCTGGGAAGCAGG + Intergenic
934157048 2:89212913-89212935 ATCTGGGTAGTGTTGGAAGAAGG + Intergenic
934210268 2:89969833-89969855 ATCTGGGTAGTGTTGGAAGAAGG - Intergenic
934384618 2:92961631-92961653 TTGAGGATATTGTTGGAAACGGG + Intergenic
934420282 2:93536450-93536472 TTGAGGATATTGTTGGAAACGGG + Intergenic
934470444 2:94525073-94525095 TTGAGGGTCTTGTTGGAAACGGG - Intergenic
936030250 2:109065140-109065162 ATGTTGGCTTTGTTGGAAGCTGG - Intergenic
941753225 2:169156073-169156095 ATGTAGCTATTGTTTTAAGCTGG + Intronic
942040034 2:172051633-172051655 ATGTTGTTATTATTGGAAGAGGG + Intronic
947050118 2:226032102-226032124 AAGAGAGTGTTGTTGGAAGCTGG + Intergenic
947389248 2:229622625-229622647 ATGTGGATTTTTTTGGAAACAGG + Intronic
948825424 2:240571484-240571506 ATGTGGCTGTGGTTGGAAGAGGG + Intronic
948926019 2:241098538-241098560 ATGTGAATATTGTTGGGGGCAGG + Intronic
1171530393 20:25849367-25849389 TTGTGGGTGGTGTAGGAAGCAGG - Intronic
1173215915 20:41083299-41083321 ATGTGGGTATGTTTGGGAGAAGG - Intronic
1178328841 21:31668400-31668422 TTTTGGGTATTGTTGGGAGGAGG + Intronic
1178815435 21:35924997-35925019 ATGTGCGTATTCTTGGGAGTTGG - Intronic
1179295472 21:40058233-40058255 ATGTGGGTTTTGGGGGTAGCAGG - Intronic
1180424879 22:15164759-15164781 TTGAGGGTCTTGTTGGAAACGGG - Intergenic
1182934156 22:34205352-34205374 AAGTGGGTATTGTTTAAACCTGG - Intergenic
955302701 3:57797564-57797586 ATGTGGTTATTCTTGGAAGCTGG + Intronic
957068785 3:75549134-75549156 AGGTGGGTGTGGTTGAAAGCAGG - Intergenic
957403583 3:79749145-79749167 ATGAGGATCTTGTTGGAAACTGG + Intronic
958210214 3:90465287-90465309 TTGAGGGTTTTGTTGGAAACGGG - Intergenic
958219127 3:90639251-90639273 ATGAGGTCATTGTTGGAAACAGG - Intergenic
958475885 3:94581707-94581729 ATATGTGTATAGTTAGAAGCTGG + Intergenic
959071452 3:101705479-101705501 AAGTGGGTAATGGTTGAAGCTGG + Intergenic
959397167 3:105854992-105855014 CTGTGGGTATTTTTGGAATCTGG + Intronic
961284631 3:125791193-125791215 AGGTGGGTGTGGTTGAAAGCAGG + Intergenic
961312458 3:126012188-126012210 AAGTGGGTGTTGTTGGGAGGAGG - Intronic
962779436 3:138697824-138697846 ATGGGAGAATTGTTGGAATCTGG - Intronic
965284404 3:166799695-166799717 AGGGGGGTATTGTAGAAAGCTGG + Intergenic
967023892 3:185547045-185547067 AGGTGGGAATTGTTTGAACCCGG + Intronic
969073128 4:4555828-4555850 ATGTGGGTGTTGTTGGACTTTGG + Intergenic
969863067 4:10052848-10052870 ATGTGGATATTTTTGGGAGCAGG - Intronic
970461979 4:16283783-16283805 ATGGAGATATTGTTGGAAACTGG + Intergenic
971456187 4:26847020-26847042 ATGGGTGTATGGGTGGAAGCTGG - Intergenic
972183382 4:36497269-36497291 CTATGGGTCTTGGTGGAAGCGGG - Intergenic
972845211 4:42980706-42980728 ATCTGTCTATTGTTGAAAGCGGG + Intronic
973432128 4:50168726-50168748 TTGTGGGTTTCGTTGGAAACGGG + Intergenic
973432869 4:50180968-50180990 TTGAGGATATCGTTGGAAGCGGG + Intergenic
973447714 4:50427001-50427023 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
973461099 4:50647540-50647562 TTGTGGGTTTCGTTGGAAACGGG + Intergenic
973471333 4:50816194-50816216 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
973477614 4:50920395-50920417 TTGAGGATATCGTTGGAAGCGGG + Intergenic
973491316 4:51146226-51146248 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
973492603 4:51167489-51167511 TTGTGGATTTTGTTGGAAACGGG + Intergenic
973495215 4:51210689-51210711 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
973504444 4:51363062-51363084 TTGTGGATTTCGTTGGAAGCGGG + Intergenic
973513862 4:51517672-51517694 TTGTGGGTTTCGTTGGAAACGGG + Intergenic
975953206 4:79800591-79800613 ATGTGGCTATATTTGGAAACTGG + Intergenic
977981600 4:103329511-103329533 TTCTGGGTATTTTTGGAATCAGG + Intergenic
980181271 4:129404226-129404248 ATTTGGGGATTGTTCAAAGCTGG + Intergenic
982780436 4:159484808-159484830 ATGTGGGTAATCTTGGATTCAGG + Intergenic
983248078 4:165311548-165311570 GTGTGGGTGTTGTTGGAGGTAGG + Exonic
983855861 4:172643579-172643601 TAGTGGGAATTGTTGGAAGCTGG - Intronic
984947693 4:184982879-184982901 ATTTGGGGATTTTTGGAGGCTGG - Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
986794168 5:11192660-11192682 ATGTGGGCAGCTTTGGAAGCTGG + Intronic
987735597 5:21838868-21838890 ATGTGGGTATGGATGAAGGCTGG - Intronic
988394364 5:30678695-30678717 ATGAGGGACTTGTTGGAAACTGG + Intergenic
988780224 5:34514009-34514031 AAGTGGGAAATGTTGGAAACAGG - Intergenic
990029855 5:51244472-51244494 ATTTGGGTATGATTGGCAGCAGG + Intergenic
991941246 5:71854298-71854320 ATGTGGAACTTGTTGGAAACTGG - Intergenic
992203109 5:74403424-74403446 GTGTGCCTATTCTTGGAAGCTGG - Intergenic
993256452 5:85596699-85596721 TTGTGGGCAGTGTTGGAAGGTGG + Intergenic
994797685 5:104325946-104325968 ATATGGGGATTTTTAGAAGCTGG - Intergenic
995461680 5:112410379-112410401 AGGTGGTTAATGCTGGAAGCAGG + Intronic
996628257 5:125597065-125597087 ATGTGGGTGTTATTGGGAGGGGG - Intergenic
996943679 5:129041764-129041786 ATTTATGTATTGTTGGATGCTGG - Intergenic
996976255 5:129438703-129438725 TTGTGGATAGTGTTGGCAGCAGG - Intergenic
997432081 5:133847715-133847737 ATCTGGGTATTGCTGGGAGATGG - Intergenic
997466266 5:134090106-134090128 ATGTGGGGACTGATGGAAGGAGG - Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998290296 5:140908268-140908290 ATGAGGCCATTGTTGCAAGCTGG + Intronic
999054805 5:148562950-148562972 ATGTGAGAAATGATGGAAGCAGG - Intronic
1000543749 5:162573062-162573084 ATGTGGGTATAGTTAGAAAATGG + Intergenic
1001065455 5:168531715-168531737 ATGTGGGTCTTTTTGGCAGTTGG - Intergenic
1001132299 5:169074228-169074250 TTTTGGGTATTGTTGCTAGCTGG + Intronic
1001450592 5:171821431-171821453 CTGTGGCTATGTTTGGAAGCTGG + Intergenic
1001483413 5:172103607-172103629 TTCTGGGTATTGTTGGGAGTGGG - Intronic
1004459110 6:15819433-15819455 ATGTGGCTTTTGTTGCAGGCAGG + Intergenic
1004558652 6:16725974-16725996 ATGTGGGTATTGTGGGGAGGAGG - Intronic
1004713248 6:18192254-18192276 CTGTGGGTTTTTTTGGAAACAGG - Intronic
1004836163 6:19534034-19534056 TTGTGGATATTTTTGGATGCTGG + Intergenic
1005183543 6:23136757-23136779 ATGTGGGCACTGGTGGTAGCAGG + Intergenic
1006076036 6:31533045-31533067 ATGTGGGTATTTTTGGGAGTGGG - Intronic
1006779763 6:36624359-36624381 TGGTTGGTATGGTTGGAAGCCGG - Intergenic
1007146234 6:39635898-39635920 ATTTGGGTCTTGTGGCAAGCAGG + Intronic
1007323755 6:41044724-41044746 ATGTTTGTATTTTTGGAGGCAGG - Intronic
1007940823 6:45779672-45779694 ATGTGGGTATTGATGGCATAAGG - Intergenic
1010249609 6:73694355-73694377 AAGTGTGTATTGTGGGAAGGAGG + Intergenic
1010868123 6:81005754-81005776 ATGAGGAACTTGTTGGAAGCTGG + Intergenic
1011585698 6:88922819-88922841 TTGTAGGTATTGTTGGATCCTGG - Intronic
1012721322 6:102749918-102749940 ATGTGGGTGGTGGTAGAAGCTGG - Intergenic
1012868388 6:104644864-104644886 ATGGGGGTGTGATTGGAAGCTGG - Intergenic
1016571212 6:145515135-145515157 GTATGGGTATTGTTGGTAGAAGG + Intronic
1021104793 7:16625045-16625067 ACATGGGTAATGTTAGAAGCTGG - Exonic
1022024521 7:26434385-26434407 ATATGAGCATTGTTGAAAGCGGG + Intergenic
1023115548 7:36858488-36858510 ATGTGGGTGTCTTTGGAAGGCGG - Intronic
1023186189 7:37535788-37535810 CTGTCAGTATTGTTGGGAGCAGG + Intergenic
1023941719 7:44772644-44772666 ATGTGGAGACTGTTGGGAGCAGG - Intergenic
1027575361 7:79923624-79923646 ATGTGAGTATTCATGGAAGAAGG - Intergenic
1028905539 7:96150541-96150563 ATGTGACTATAGTTGGAAACAGG + Intronic
1028966048 7:96802417-96802439 ATGAGGTTAATCTTGGAAGCTGG + Intergenic
1030101267 7:105947532-105947554 TTGTGGATATAGTTGGAAGTAGG - Intronic
1030754516 7:113271826-113271848 ATGTGTGTCTTGTAGGCAGCAGG - Intergenic
1031301544 7:120067501-120067523 ATGAGGAAATTGTTGGAAACTGG + Intergenic
1032260190 7:130329595-130329617 ATGTGGTTGTGTTTGGAAGCTGG - Intergenic
1033584315 7:142762839-142762861 ATGTGGGCATTGATGACAGCAGG - Intronic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1039153767 8:34532375-34532397 ATGAGGGTGTGGCTGGAAGCAGG + Intergenic
1039708777 8:40034498-40034520 ATGTGGGTCTTTCTGGAGGCAGG - Intergenic
1040372951 8:46795051-46795073 ATGTGTGTACTGTTCCAAGCAGG + Intergenic
1045316328 8:101046739-101046761 ATAAGGGCATTGTTGGTAGCTGG - Intergenic
1046618190 8:116500246-116500268 ATGAGGAAATTGTTGGAAACTGG - Intergenic
1047002813 8:120589809-120589831 ATGTGGTGATATTTGGAAGCAGG - Intronic
1049092683 8:140528515-140528537 AAGAGGGAACTGTTGGAAGCAGG - Intergenic
1050738619 9:8793117-8793139 ATATGTGCATAGTTGGAAGCAGG - Intronic
1052755494 9:32536859-32536881 TTGTAGGCATTGTTGGAAGTAGG - Intergenic
1054424756 9:65051040-65051062 TTGTGGATTTTGTTGGAAACGGG + Intergenic
1055402990 9:75944313-75944335 ATGTGGCTATTGTTTTATGCAGG + Intronic
1056468812 9:86885345-86885367 AGGCGGGAACTGTTGGAAGCAGG - Intergenic
1057823409 9:98352526-98352548 ATGTGGGTGGTGATGGCAGCAGG + Intronic
1058418413 9:104811905-104811927 ATGTGGATATTGTTAAGAGCGGG - Intronic
1061957613 9:133971739-133971761 CTGTGGGTTTTGTTGACAGCTGG - Intronic
1186353652 X:8767001-8767023 ATGAAAGTATTGTTGGGAGCAGG - Intergenic
1186907565 X:14127958-14127980 ATGGGGGTATTGTGTGATGCTGG + Intergenic
1188004284 X:25006578-25006600 ATGGGGGTGTCGTTGGCAGCGGG + Intronic
1188212916 X:27444794-27444816 ATGTTGATATTGATGGAGGCAGG - Intergenic
1188485045 X:30673195-30673217 ATGTGGGTAAAGTATGAAGCTGG + Intronic
1189569459 X:42280154-42280176 ATGCTGGTGTTGTTGGGAGCTGG + Intergenic
1194267123 X:91767974-91767996 ATCTTGGTTTTGTTGGAATCTGG + Intergenic
1200252588 X:154561606-154561628 AAGGGGGTAGAGTTGGAAGCAGG + Intronic
1200265179 X:154642810-154642832 AAGGGGGTAGAGTTGGAAGCAGG - Intergenic
1200296171 X:154922974-154922996 ATGAGGGTAAGGTTGGAAACAGG + Intronic
1200584327 Y:4988913-4988935 ATCTTGGTTTTGTTGGAAGCTGG + Intergenic