ID: 1075333844

View in Genome Browser
Species Human (GRCh38)
Location 10:121595294-121595316
Sequence CTGAGGACAAAAATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075333838_1075333844 15 Left 1075333838 10:121595256-121595278 CCAAATCTCATCATAAAAACTGC 0: 1
1: 0
2: 0
3: 21
4: 251
Right 1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG No data
1075333837_1075333844 16 Left 1075333837 10:121595255-121595277 CCCAAATCTCATCATAAAAACTG 0: 1
1: 0
2: 2
3: 48
4: 463
Right 1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG No data
1075333835_1075333844 20 Left 1075333835 10:121595251-121595273 CCTCCCCAAATCTCATCATAAAA 0: 1
1: 0
2: 24
3: 860
4: 12949
Right 1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG No data
1075333840_1075333844 -9 Left 1075333840 10:121595280-121595302 CCTTTTAGCTTTGACTGAGGACA 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG No data
1075333836_1075333844 17 Left 1075333836 10:121595254-121595276 CCCCAAATCTCATCATAAAAACT 0: 1
1: 0
2: 2
3: 51
4: 577
Right 1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075333844 Original CRISPR CTGAGGACAAAAATGGAGGA GGG Intronic
No off target data available for this crispr