ID: 1075335291

View in Genome Browser
Species Human (GRCh38)
Location 10:121604509-121604531
Sequence CAGGGCACACAGAGGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075335285_1075335291 2 Left 1075335285 10:121604484-121604506 CCCTGGATTTTACAGGGGAAGAA No data
Right 1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG No data
1075335286_1075335291 1 Left 1075335286 10:121604485-121604507 CCTGGATTTTACAGGGGAAGAAA No data
Right 1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG No data
1075335279_1075335291 27 Left 1075335279 10:121604459-121604481 CCTATGACAGCGCATCAAGTATG No data
Right 1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG No data
1075335284_1075335291 3 Left 1075335284 10:121604483-121604505 CCCCTGGATTTTACAGGGGAAGA No data
Right 1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075335291 Original CRISPR CAGGGCACACAGAGGGATGA TGG Intergenic
No off target data available for this crispr