ID: 1075337208

View in Genome Browser
Species Human (GRCh38)
Location 10:121617153-121617175
Sequence TTGGAAAAGGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075337203_1075337208 -1 Left 1075337203 10:121617131-121617153 CCTCGAGTTAAGGGTTTTGTGCT No data
Right 1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG No data
1075337200_1075337208 20 Left 1075337200 10:121617110-121617132 CCATTCAGTGGGTTGCTTTAACC No data
Right 1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075337208 Original CRISPR TTGGAAAAGGAGAAGGAGGA AGG Intergenic
No off target data available for this crispr