ID: 1075341004

View in Genome Browser
Species Human (GRCh38)
Location 10:121646800-121646822
Sequence CCTCCCCTCGCCCCCAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075341004_1075341018 19 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341018 10:121646842-121646864 TGGGTAAGGGGTTTTCTCTGGGG No data
1075341004_1075341016 17 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341016 10:121646840-121646862 TCTGGGTAAGGGGTTTTCTCTGG No data
1075341004_1075341012 5 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341012 10:121646828-121646850 GGACTGACTACCTCTGGGTAAGG No data
1075341004_1075341013 6 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341013 10:121646829-121646851 GACTGACTACCTCTGGGTAAGGG No data
1075341004_1075341019 25 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341019 10:121646848-121646870 AGGGGTTTTCTCTGGGGATGAGG No data
1075341004_1075341011 0 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341011 10:121646823-121646845 AGGGAGGACTGACTACCTCTGGG No data
1075341004_1075341014 7 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341014 10:121646830-121646852 ACTGACTACCTCTGGGTAAGGGG No data
1075341004_1075341010 -1 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341010 10:121646822-121646844 GAGGGAGGACTGACTACCTCTGG No data
1075341004_1075341017 18 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341017 10:121646841-121646863 CTGGGTAAGGGGTTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075341004 Original CRISPR CCTCCCCTCGCCCCCAGGCT TGG (reversed) Intergenic
No off target data available for this crispr