ID: 1075341019

View in Genome Browser
Species Human (GRCh38)
Location 10:121646848-121646870
Sequence AGGGGTTTTCTCTGGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075341004_1075341019 25 Left 1075341004 10:121646800-121646822 CCAAGCCTGGGGGCGAGGGGAGG No data
Right 1075341019 10:121646848-121646870 AGGGGTTTTCTCTGGGGATGAGG No data
1075341008_1075341019 20 Left 1075341008 10:121646805-121646827 CCTGGGGGCGAGGGGAGGAGGGA No data
Right 1075341019 10:121646848-121646870 AGGGGTTTTCTCTGGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075341019 Original CRISPR AGGGGTTTTCTCTGGGGATG AGG Intergenic
No off target data available for this crispr