ID: 1075341265

View in Genome Browser
Species Human (GRCh38)
Location 10:121648440-121648462
Sequence CAGACTAGGTAGTAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075341265_1075341274 26 Left 1075341265 10:121648440-121648462 CCTGCCTCCTACTACCTAGTCTG No data
Right 1075341274 10:121648489-121648511 TTAGCGCTTTGAAGACTTAGTGG No data
1075341265_1075341273 -4 Left 1075341265 10:121648440-121648462 CCTGCCTCCTACTACCTAGTCTG No data
Right 1075341273 10:121648459-121648481 TCTGCATGGAAATGGGAGAAGGG No data
1075341265_1075341272 -5 Left 1075341265 10:121648440-121648462 CCTGCCTCCTACTACCTAGTCTG No data
Right 1075341272 10:121648458-121648480 GTCTGCATGGAAATGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075341265 Original CRISPR CAGACTAGGTAGTAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr