ID: 1075342198

View in Genome Browser
Species Human (GRCh38)
Location 10:121655930-121655952
Sequence ATCCCACTTGAGTCCCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075342198_1075342206 23 Left 1075342198 10:121655930-121655952 CCTCCGGGGGACTCAAGTGGGAT No data
Right 1075342206 10:121655976-121655998 GGAAAGGCAAGTGTATGAAGAGG No data
1075342198_1075342202 7 Left 1075342198 10:121655930-121655952 CCTCCGGGGGACTCAAGTGGGAT No data
Right 1075342202 10:121655960-121655982 CCCTGCCCAAGTTACAGGAAAGG No data
1075342198_1075342207 28 Left 1075342198 10:121655930-121655952 CCTCCGGGGGACTCAAGTGGGAT No data
Right 1075342207 10:121655981-121656003 GGCAAGTGTATGAAGAGGCCAGG No data
1075342198_1075342200 2 Left 1075342198 10:121655930-121655952 CCTCCGGGGGACTCAAGTGGGAT No data
Right 1075342200 10:121655955-121655977 CAATTCCCTGCCCAAGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075342198 Original CRISPR ATCCCACTTGAGTCCCCCGG AGG (reversed) Intergenic
No off target data available for this crispr