ID: 1075343819

View in Genome Browser
Species Human (GRCh38)
Location 10:121667791-121667813
Sequence TGTCATAGACACAGTGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075343819_1075343828 30 Left 1075343819 10:121667791-121667813 CCCTGGCCACTGTGTCTATGACA No data
Right 1075343828 10:121667844-121667866 CCTCTTCTGGGAGCCTCCACAGG No data
1075343819_1075343824 17 Left 1075343819 10:121667791-121667813 CCCTGGCCACTGTGTCTATGACA No data
Right 1075343824 10:121667831-121667853 GCTCAAGCACCTGCCTCTTCTGG No data
1075343819_1075343825 18 Left 1075343819 10:121667791-121667813 CCCTGGCCACTGTGTCTATGACA No data
Right 1075343825 10:121667832-121667854 CTCAAGCACCTGCCTCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075343819 Original CRISPR TGTCATAGACACAGTGGCCA GGG (reversed) Intergenic
No off target data available for this crispr