ID: 1075344582

View in Genome Browser
Species Human (GRCh38)
Location 10:121672919-121672941
Sequence CCATGGGAGGCGCTGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075344572_1075344582 16 Left 1075344572 10:121672880-121672902 CCAGTGAAGAGAAGACAAAGGAG No data
Right 1075344582 10:121672919-121672941 CCATGGGAGGCGCTGTGGTGGGG No data
1075344570_1075344582 30 Left 1075344570 10:121672866-121672888 CCTCATTCTTGAGACCAGTGAAG No data
Right 1075344582 10:121672919-121672941 CCATGGGAGGCGCTGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075344582 Original CRISPR CCATGGGAGGCGCTGTGGTG GGG Intergenic
No off target data available for this crispr