ID: 1075344598

View in Genome Browser
Species Human (GRCh38)
Location 10:121673028-121673050
Sequence TCCTTCTCCTCTTGCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075344598_1075344604 -3 Left 1075344598 10:121673028-121673050 CCCAGAGGGCAAGAGGAGAAGGA No data
Right 1075344604 10:121673048-121673070 GGACGTTCGGCAAGAGGGGAAGG No data
1075344598_1075344602 -8 Left 1075344598 10:121673028-121673050 CCCAGAGGGCAAGAGGAGAAGGA No data
Right 1075344602 10:121673043-121673065 GAGAAGGACGTTCGGCAAGAGGG No data
1075344598_1075344605 12 Left 1075344598 10:121673028-121673050 CCCAGAGGGCAAGAGGAGAAGGA No data
Right 1075344605 10:121673063-121673085 GGGGAAGGACATTCAGCAAGAGG No data
1075344598_1075344601 -9 Left 1075344598 10:121673028-121673050 CCCAGAGGGCAAGAGGAGAAGGA No data
Right 1075344601 10:121673042-121673064 GGAGAAGGACGTTCGGCAAGAGG No data
1075344598_1075344603 -7 Left 1075344598 10:121673028-121673050 CCCAGAGGGCAAGAGGAGAAGGA No data
Right 1075344603 10:121673044-121673066 AGAAGGACGTTCGGCAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075344598 Original CRISPR TCCTTCTCCTCTTGCCCTCT GGG (reversed) Intergenic