ID: 1075344599

View in Genome Browser
Species Human (GRCh38)
Location 10:121673029-121673051
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075344599_1075344602 -9 Left 1075344599 10:121673029-121673051 CCAGAGGGCAAGAGGAGAAGGAC No data
Right 1075344602 10:121673043-121673065 GAGAAGGACGTTCGGCAAGAGGG No data
1075344599_1075344601 -10 Left 1075344599 10:121673029-121673051 CCAGAGGGCAAGAGGAGAAGGAC No data
Right 1075344601 10:121673042-121673064 GGAGAAGGACGTTCGGCAAGAGG No data
1075344599_1075344605 11 Left 1075344599 10:121673029-121673051 CCAGAGGGCAAGAGGAGAAGGAC No data
Right 1075344605 10:121673063-121673085 GGGGAAGGACATTCAGCAAGAGG No data
1075344599_1075344604 -4 Left 1075344599 10:121673029-121673051 CCAGAGGGCAAGAGGAGAAGGAC No data
Right 1075344604 10:121673048-121673070 GGACGTTCGGCAAGAGGGGAAGG No data
1075344599_1075344603 -8 Left 1075344599 10:121673029-121673051 CCAGAGGGCAAGAGGAGAAGGAC No data
Right 1075344603 10:121673044-121673066 AGAAGGACGTTCGGCAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075344599 Original CRISPR GTCCTTCTCCTCTTGCCCTC TGG (reversed) Intergenic