ID: 1075344603

View in Genome Browser
Species Human (GRCh38)
Location 10:121673044-121673066
Sequence AGAAGGACGTTCGGCAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075344599_1075344603 -8 Left 1075344599 10:121673029-121673051 CCAGAGGGCAAGAGGAGAAGGAC No data
Right 1075344603 10:121673044-121673066 AGAAGGACGTTCGGCAAGAGGGG No data
1075344598_1075344603 -7 Left 1075344598 10:121673028-121673050 CCCAGAGGGCAAGAGGAGAAGGA No data
Right 1075344603 10:121673044-121673066 AGAAGGACGTTCGGCAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075344603 Original CRISPR AGAAGGACGTTCGGCAAGAG GGG Intergenic