ID: 1075344605

View in Genome Browser
Species Human (GRCh38)
Location 10:121673063-121673085
Sequence GGGGAAGGACATTCAGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075344599_1075344605 11 Left 1075344599 10:121673029-121673051 CCAGAGGGCAAGAGGAGAAGGAC No data
Right 1075344605 10:121673063-121673085 GGGGAAGGACATTCAGCAAGAGG No data
1075344598_1075344605 12 Left 1075344598 10:121673028-121673050 CCCAGAGGGCAAGAGGAGAAGGA No data
Right 1075344605 10:121673063-121673085 GGGGAAGGACATTCAGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075344605 Original CRISPR GGGGAAGGACATTCAGCAAG AGG Intergenic