ID: 1075345416

View in Genome Browser
Species Human (GRCh38)
Location 10:121678617-121678639
Sequence ACCCCTGCCCATGCAGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075345416_1075345424 28 Left 1075345416 10:121678617-121678639 CCTAGCCCTGCATGGGCAGGGGT No data
Right 1075345424 10:121678668-121678690 ACACTCACACAGCCAGGCCTTGG No data
1075345416_1075345425 29 Left 1075345416 10:121678617-121678639 CCTAGCCCTGCATGGGCAGGGGT No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data
1075345416_1075345422 22 Left 1075345416 10:121678617-121678639 CCTAGCCCTGCATGGGCAGGGGT No data
Right 1075345422 10:121678662-121678684 AGCCAGACACTCACACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075345416 Original CRISPR ACCCCTGCCCATGCAGGGCT AGG (reversed) Intergenic