ID: 1075345419

View in Genome Browser
Species Human (GRCh38)
Location 10:121678643-121678665
Sequence GGCTCTGTTGGTCTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075345419_1075345422 -4 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345422 10:121678662-121678684 AGCCAGACACTCACACAGCCAGG No data
1075345419_1075345429 14 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345429 10:121678680-121678702 CCAGGCCTTGGGAACACCTGGGG No data
1075345419_1075345432 30 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345432 10:121678696-121678718 CCTGGGGTGAGCTCCAGAACAGG No data
1075345419_1075345427 13 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345427 10:121678679-121678701 GCCAGGCCTTGGGAACACCTGGG No data
1075345419_1075345425 3 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data
1075345419_1075345426 12 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345426 10:121678678-121678700 AGCCAGGCCTTGGGAACACCTGG No data
1075345419_1075345424 2 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345424 10:121678668-121678690 ACACTCACACAGCCAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075345419 Original CRISPR GGCTCTGTTGGTCTTGAGGC TGG (reversed) Intergenic