ID: 1075345421

View in Genome Browser
Species Human (GRCh38)
Location 10:121678655-121678677
Sequence GTGTGAGTGTCTGGCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075345421_1075345425 -9 Left 1075345421 10:121678655-121678677 CCAACAGAGCCAGACACTCACAC No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data
1075345421_1075345424 -10 Left 1075345421 10:121678655-121678677 CCAACAGAGCCAGACACTCACAC No data
Right 1075345424 10:121678668-121678690 ACACTCACACAGCCAGGCCTTGG No data
1075345421_1075345427 1 Left 1075345421 10:121678655-121678677 CCAACAGAGCCAGACACTCACAC No data
Right 1075345427 10:121678679-121678701 GCCAGGCCTTGGGAACACCTGGG No data
1075345421_1075345426 0 Left 1075345421 10:121678655-121678677 CCAACAGAGCCAGACACTCACAC No data
Right 1075345426 10:121678678-121678700 AGCCAGGCCTTGGGAACACCTGG No data
1075345421_1075345433 19 Left 1075345421 10:121678655-121678677 CCAACAGAGCCAGACACTCACAC No data
Right 1075345433 10:121678697-121678719 CTGGGGTGAGCTCCAGAACAGGG No data
1075345421_1075345429 2 Left 1075345421 10:121678655-121678677 CCAACAGAGCCAGACACTCACAC No data
Right 1075345429 10:121678680-121678702 CCAGGCCTTGGGAACACCTGGGG No data
1075345421_1075345432 18 Left 1075345421 10:121678655-121678677 CCAACAGAGCCAGACACTCACAC No data
Right 1075345432 10:121678696-121678718 CCTGGGGTGAGCTCCAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075345421 Original CRISPR GTGTGAGTGTCTGGCTCTGT TGG (reversed) Intergenic