ID: 1075345422

View in Genome Browser
Species Human (GRCh38)
Location 10:121678662-121678684
Sequence AGCCAGACACTCACACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075345417_1075345422 17 Left 1075345417 10:121678622-121678644 CCCTGCATGGGCAGGGGTCATCC No data
Right 1075345422 10:121678662-121678684 AGCCAGACACTCACACAGCCAGG No data
1075345418_1075345422 16 Left 1075345418 10:121678623-121678645 CCTGCATGGGCAGGGGTCATCCA No data
Right 1075345422 10:121678662-121678684 AGCCAGACACTCACACAGCCAGG No data
1075345414_1075345422 23 Left 1075345414 10:121678616-121678638 CCCTAGCCCTGCATGGGCAGGGG No data
Right 1075345422 10:121678662-121678684 AGCCAGACACTCACACAGCCAGG No data
1075345420_1075345422 -8 Left 1075345420 10:121678647-121678669 CCTCAAGACCAACAGAGCCAGAC No data
Right 1075345422 10:121678662-121678684 AGCCAGACACTCACACAGCCAGG No data
1075345416_1075345422 22 Left 1075345416 10:121678617-121678639 CCTAGCCCTGCATGGGCAGGGGT No data
Right 1075345422 10:121678662-121678684 AGCCAGACACTCACACAGCCAGG No data
1075345419_1075345422 -4 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345422 10:121678662-121678684 AGCCAGACACTCACACAGCCAGG No data
1075345411_1075345422 27 Left 1075345411 10:121678612-121678634 CCTACCCTAGCCCTGCATGGGCA No data
Right 1075345422 10:121678662-121678684 AGCCAGACACTCACACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075345422 Original CRISPR AGCCAGACACTCACACAGCC AGG Intergenic