ID: 1075345425

View in Genome Browser
Species Human (GRCh38)
Location 10:121678669-121678691
Sequence CACTCACACAGCCAGGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075345419_1075345425 3 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data
1075345420_1075345425 -1 Left 1075345420 10:121678647-121678669 CCTCAAGACCAACAGAGCCAGAC No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data
1075345418_1075345425 23 Left 1075345418 10:121678623-121678645 CCTGCATGGGCAGGGGTCATCCA No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data
1075345421_1075345425 -9 Left 1075345421 10:121678655-121678677 CCAACAGAGCCAGACACTCACAC No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data
1075345417_1075345425 24 Left 1075345417 10:121678622-121678644 CCCTGCATGGGCAGGGGTCATCC No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data
1075345414_1075345425 30 Left 1075345414 10:121678616-121678638 CCCTAGCCCTGCATGGGCAGGGG No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data
1075345416_1075345425 29 Left 1075345416 10:121678617-121678639 CCTAGCCCTGCATGGGCAGGGGT No data
Right 1075345425 10:121678669-121678691 CACTCACACAGCCAGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075345425 Original CRISPR CACTCACACAGCCAGGCCTT GGG Intergenic