ID: 1075345427

View in Genome Browser
Species Human (GRCh38)
Location 10:121678679-121678701
Sequence GCCAGGCCTTGGGAACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075345419_1075345427 13 Left 1075345419 10:121678643-121678665 CCAGCCTCAAGACCAACAGAGCC No data
Right 1075345427 10:121678679-121678701 GCCAGGCCTTGGGAACACCTGGG No data
1075345421_1075345427 1 Left 1075345421 10:121678655-121678677 CCAACAGAGCCAGACACTCACAC No data
Right 1075345427 10:121678679-121678701 GCCAGGCCTTGGGAACACCTGGG No data
1075345420_1075345427 9 Left 1075345420 10:121678647-121678669 CCTCAAGACCAACAGAGCCAGAC No data
Right 1075345427 10:121678679-121678701 GCCAGGCCTTGGGAACACCTGGG No data
1075345423_1075345427 -8 Left 1075345423 10:121678664-121678686 CCAGACACTCACACAGCCAGGCC No data
Right 1075345427 10:121678679-121678701 GCCAGGCCTTGGGAACACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075345427 Original CRISPR GCCAGGCCTTGGGAACACCT GGG Intergenic