ID: 1075345591

View in Genome Browser
Species Human (GRCh38)
Location 10:121679740-121679762
Sequence AGGGAGAGGCAGACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075345591_1075345600 11 Left 1075345591 10:121679740-121679762 CCCTCCTCAGTCTGCCTCTCCCT No data
Right 1075345600 10:121679774-121679796 ACCTGGATCACCCCAAAACAAGG No data
1075345591_1075345602 17 Left 1075345591 10:121679740-121679762 CCCTCCTCAGTCTGCCTCTCCCT No data
Right 1075345602 10:121679780-121679802 ATCACCCCAAAACAAGGAGCAGG No data
1075345591_1075345603 20 Left 1075345591 10:121679740-121679762 CCCTCCTCAGTCTGCCTCTCCCT No data
Right 1075345603 10:121679783-121679805 ACCCCAAAACAAGGAGCAGGAGG No data
1075345591_1075345595 -6 Left 1075345591 10:121679740-121679762 CCCTCCTCAGTCTGCCTCTCCCT No data
Right 1075345595 10:121679757-121679779 CTCCCTGCCTTCCTTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075345591 Original CRISPR AGGGAGAGGCAGACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr