ID: 1075348949

View in Genome Browser
Species Human (GRCh38)
Location 10:121706527-121706549
Sequence TTCTGACCTCCACTTTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075348949_1075348959 28 Left 1075348949 10:121706527-121706549 CCTCTCTAAAGTGGAGGTCAGAA No data
Right 1075348959 10:121706578-121706600 TGGACTTCTTGAGAGGTGGATGG No data
1075348949_1075348954 8 Left 1075348949 10:121706527-121706549 CCTCTCTAAAGTGGAGGTCAGAA No data
Right 1075348954 10:121706558-121706580 TGACCCAGACACACTGAGGCTGG No data
1075348949_1075348958 24 Left 1075348949 10:121706527-121706549 CCTCTCTAAAGTGGAGGTCAGAA No data
Right 1075348958 10:121706574-121706596 AGGCTGGACTTCTTGAGAGGTGG No data
1075348949_1075348957 21 Left 1075348949 10:121706527-121706549 CCTCTCTAAAGTGGAGGTCAGAA No data
Right 1075348957 10:121706571-121706593 CTGAGGCTGGACTTCTTGAGAGG No data
1075348949_1075348960 29 Left 1075348949 10:121706527-121706549 CCTCTCTAAAGTGGAGGTCAGAA No data
Right 1075348960 10:121706579-121706601 GGACTTCTTGAGAGGTGGATGGG No data
1075348949_1075348953 4 Left 1075348949 10:121706527-121706549 CCTCTCTAAAGTGGAGGTCAGAA No data
Right 1075348953 10:121706554-121706576 CGGGTGACCCAGACACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075348949 Original CRISPR TTCTGACCTCCACTTTAGAG AGG (reversed) Intergenic
No off target data available for this crispr