ID: 1075352575

View in Genome Browser
Species Human (GRCh38)
Location 10:121737108-121737130
Sequence GTTATTTTACTAACAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075352575_1075352577 8 Left 1075352575 10:121737108-121737130 CCTGGCTTTGTTAGTAAAATAAC No data
Right 1075352577 10:121737139-121737161 TTGCAACGTGGCTCAAGAACAGG No data
1075352575_1075352579 27 Left 1075352575 10:121737108-121737130 CCTGGCTTTGTTAGTAAAATAAC No data
Right 1075352579 10:121737158-121737180 CAGGCAGAAACCAGGAAGACTGG No data
1075352575_1075352578 19 Left 1075352575 10:121737108-121737130 CCTGGCTTTGTTAGTAAAATAAC No data
Right 1075352578 10:121737150-121737172 CTCAAGAACAGGCAGAAACCAGG No data
1075352575_1075352576 -4 Left 1075352575 10:121737108-121737130 CCTGGCTTTGTTAGTAAAATAAC No data
Right 1075352576 10:121737127-121737149 TAACAAATAGAATTGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075352575 Original CRISPR GTTATTTTACTAACAAAGCC AGG (reversed) Intergenic
No off target data available for this crispr