ID: 1075352576

View in Genome Browser
Species Human (GRCh38)
Location 10:121737127-121737149
Sequence TAACAAATAGAATTGCAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075352573_1075352576 14 Left 1075352573 10:121737090-121737112 CCACACACTGATTATTTTCCTGG No data
Right 1075352576 10:121737127-121737149 TAACAAATAGAATTGCAACGTGG No data
1075352575_1075352576 -4 Left 1075352575 10:121737108-121737130 CCTGGCTTTGTTAGTAAAATAAC No data
Right 1075352576 10:121737127-121737149 TAACAAATAGAATTGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075352576 Original CRISPR TAACAAATAGAATTGCAACG TGG Intergenic
No off target data available for this crispr