ID: 1075352579

View in Genome Browser
Species Human (GRCh38)
Location 10:121737158-121737180
Sequence CAGGCAGAAACCAGGAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075352575_1075352579 27 Left 1075352575 10:121737108-121737130 CCTGGCTTTGTTAGTAAAATAAC No data
Right 1075352579 10:121737158-121737180 CAGGCAGAAACCAGGAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075352579 Original CRISPR CAGGCAGAAACCAGGAAGAC TGG Intergenic
No off target data available for this crispr