ID: 1075353178

View in Genome Browser
Species Human (GRCh38)
Location 10:121744741-121744763
Sequence CTGTGTACCCTGAAGAAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075353178_1075353183 16 Left 1075353178 10:121744741-121744763 CCGGTTTTCTTCAGGGTACACAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1075353183 10:121744780-121744802 CCTGTTTCCCAGCCTTCCTGTGG No data
1075353178_1075353184 20 Left 1075353178 10:121744741-121744763 CCGGTTTTCTTCAGGGTACACAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1075353184 10:121744784-121744806 TTTCCCAGCCTTCCTGTGGCTGG No data
1075353178_1075353185 21 Left 1075353178 10:121744741-121744763 CCGGTTTTCTTCAGGGTACACAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1075353185 10:121744785-121744807 TTCCCAGCCTTCCTGTGGCTGGG No data
1075353178_1075353188 26 Left 1075353178 10:121744741-121744763 CCGGTTTTCTTCAGGGTACACAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1075353188 10:121744790-121744812 AGCCTTCCTGTGGCTGGGTGTGG No data
1075353178_1075353189 27 Left 1075353178 10:121744741-121744763 CCGGTTTTCTTCAGGGTACACAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1075353189 10:121744791-121744813 GCCTTCCTGTGGCTGGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075353178 Original CRISPR CTGTGTACCCTGAAGAAAAC CGG (reversed) Intronic
900824525 1:4915563-4915585 CTGTGTTCATTGTAGAAAACTGG + Intergenic
902115020 1:14114209-14114231 CTGTGTAGCCTGAAAATAATGGG - Intergenic
902329393 1:15723870-15723892 CTGTCTGCCCGGAAGAAAAGAGG - Intronic
907921823 1:58921187-58921209 CTGTGCATCCAGAAGAAAACAGG - Intergenic
909093987 1:71264158-71264180 CAGTGTACCCTGAGAAAAATCGG - Intergenic
911411588 1:97516055-97516077 CTGTTTACAATGAAAAAAACTGG + Intronic
911819071 1:102393204-102393226 CTATGAACACTGAAGAAAACAGG + Intergenic
913684224 1:121216143-121216165 CTGTGTCTCCTGAAGAATACTGG - Intronic
914036064 1:144003758-144003780 CTGTGTCTCCTGAAGAATACTGG - Intergenic
914153395 1:145064187-145064209 CTGTGTCTCCTGAAGAATACTGG + Intronic
915662742 1:157417342-157417364 ATGTGTACCCTGTAGAAATGTGG - Intergenic
918687290 1:187433668-187433690 CTGTGGAACAAGAAGAAAACTGG + Intergenic
920471530 1:206234635-206234657 CTGTGTCTCCCGAAGAATACTGG - Intronic
923100516 1:230811002-230811024 GTATGTACCCGAAAGAAAACAGG - Intergenic
1064347619 10:14547127-14547149 CAGTGTACCCAGAAGAACCCTGG - Intronic
1068076319 10:52259823-52259845 CTGTTTTCCCTGAAGTAAACTGG + Intronic
1070419037 10:76218191-76218213 CTGTGTGCACTGAGGAAAAGAGG + Intronic
1070808379 10:79284514-79284536 CATTGTATCCTGAAGTAAACAGG + Intronic
1072250163 10:93575614-93575636 CTGTGTAAGCTGAAGGACACAGG - Intronic
1072425481 10:95326579-95326601 CTCCGTCCCCTGAAAAAAACTGG - Intronic
1073611831 10:104951738-104951760 TTTTGAACCCTGGAGAAAACTGG + Intronic
1075353178 10:121744741-121744763 CTGTGTACCCTGAAGAAAACCGG - Intronic
1076873290 10:133203983-133204005 CTGTGTACCCTGACGCATCCAGG - Intronic
1079427718 11:20359485-20359507 TTGTATGCCCTGAAGAAAACTGG + Intergenic
1080139826 11:28903257-28903279 CTGTGTACCCTGCAGCATCCTGG - Intergenic
1080176879 11:29374274-29374296 CTGTGTAAGCTGAAGAACAGTGG - Intergenic
1081085242 11:38791254-38791276 ATGTGTCTCCTGAAGAGAACAGG + Intergenic
1082742810 11:56929557-56929579 CTGTGTAATCTGAAGAAAGTTGG + Intergenic
1086377221 11:86213695-86213717 CTGTGTGCCCTAAAGAAGAGGGG - Intergenic
1089190156 11:116647907-116647929 CCCTGAACCCTGAAGAACACAGG - Intergenic
1091431626 12:440411-440433 CTGTGTACACTTTAGAAAAAGGG + Intronic
1091601813 12:1922436-1922458 CACTGTACCCTGGAGAGAACAGG + Intergenic
1095172683 12:39054632-39054654 CTGGGCACCTTGAAAAAAACAGG + Intergenic
1097204668 12:57310264-57310286 CTGTGTCTCCTGACGCAAACTGG + Exonic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1103684705 12:122722861-122722883 CTGTGTACCGTGTAGCAAAGGGG - Intergenic
1104897035 12:132169440-132169462 CTGTGTTCCCTAAAGAACACTGG - Intergenic
1110016325 13:70409966-70409988 CAGTGTAGCTTGTAGAAAACAGG + Intergenic
1111387851 13:87551700-87551722 CTGTGTGCCATGCAGAAAATGGG + Intergenic
1112330269 13:98472023-98472045 CAGTGTACCCTGAAGAGCACTGG + Intronic
1117020446 14:51565131-51565153 CTGTGTACACAGAAGAACAAAGG - Intronic
1117235026 14:53764368-53764390 CTGAGCGCCATGAAGAAAACTGG + Intergenic
1117852024 14:59983616-59983638 CAGTGTTCCCTGAAGACATCTGG - Intronic
1118055666 14:62077166-62077188 CTGTGTGGCCTAAAGTAAACAGG - Intronic
1121808587 14:96857226-96857248 CTGTGGAACTAGAAGAAAACAGG + Intronic
1122257227 14:100487630-100487652 CTGTGTTCCTTGCAGAAACCAGG + Intronic
1123780925 15:23627591-23627613 CTGTGTGCCCAAGAGAAAACAGG - Intronic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1128995438 15:72291210-72291232 CTGTGTCCCTCGAAGAAAGCTGG + Intronic
1134262028 16:12658920-12658942 TTGTGCACCCTGAACAAAAAAGG - Intergenic
1134683489 16:16142743-16142765 CTGTGTTCCTGGAAGAAAACAGG + Exonic
1139597573 16:67967394-67967416 CTGTCAACCCTGCAGGAAACAGG + Intronic
1140912042 16:79462979-79463001 CTGAGCACCCTGATTAAAACAGG - Intergenic
1141419969 16:83908134-83908156 CTGTGCATCCTGTAAAAAACTGG + Exonic
1141960983 16:87408582-87408604 CTGTGTACCATGAGGAGAAGAGG + Exonic
1142280459 16:89145200-89145222 CGGTGTCCCCTGAGGAAAAGGGG - Intronic
1142280472 16:89145253-89145275 CGGTGTCCCCTGAGGAAAAGGGG - Exonic
1142906215 17:3044064-3044086 CTGTGTGCCCTGAAAGAACCTGG - Intergenic
1145790807 17:27625490-27625512 CTGGGTTCCTTGAAGACAACAGG - Exonic
1146320874 17:31845351-31845373 CTGTGCATCTTGAAGAAATCTGG - Intergenic
1153232348 18:2950967-2950989 CTGTGTATCCATAAAAAAACTGG + Intronic
1155693598 18:28656600-28656622 CTGAATATCCTGGAGAAAACTGG - Intergenic
1156812287 18:41267120-41267142 CTCTGTACTCTAAAGAACACTGG - Intergenic
1157161877 18:45321055-45321077 CTGTGTAAACACAAGAAAACAGG - Intronic
1158689121 18:59644417-59644439 CTTTGTAAGCTGAAGAAGACAGG - Intronic
1160533444 18:79578386-79578408 CTCTGGACCCTGCAGAATACGGG - Intergenic
1167876380 19:52417109-52417131 CTTTATAGCCTGAATAAAACTGG - Exonic
925216173 2:2097446-2097468 CTGTGTGCCCTGCAGAAGCCTGG - Intronic
925515957 2:4681970-4681992 CTGAGTACCGTGCAGTAAACAGG - Intergenic
925783189 2:7402868-7402890 CTGGGTGCCCTGAAGGAAAAGGG + Intergenic
927314564 2:21666905-21666927 CAGTGTCCCCTGAAGATTACAGG - Intergenic
927385680 2:22531389-22531411 CTGTGTCCCCTTAACAATACCGG + Intergenic
928381168 2:30820057-30820079 GTGAATACCCTGAAGAAAAGAGG + Intronic
928412027 2:31061695-31061717 CTGTGCAACCTCAAGAAAAAAGG + Intronic
928565367 2:32541366-32541388 ATCTGTACACTGAATAAAACAGG - Intronic
928929376 2:36608513-36608535 CTGTGAACCTTCAAGAAAACAGG + Intronic
929652541 2:43695679-43695701 CTGTGTTCTTTCAAGAAAACAGG - Intronic
929896836 2:45967991-45968013 CTGTGTGCCCTGAACACAAAGGG + Intronic
930775875 2:55169972-55169994 CCCTGCACCCTCAAGAAAACAGG + Intergenic
933836516 2:86250308-86250330 CTCTGAAGCCTGAGGAAAACAGG - Intronic
939782373 2:146465054-146465076 GTGTGTATCCTGGGGAAAACAGG + Intergenic
940032841 2:149283259-149283281 CTGTGGAGCCTGATGAAAACAGG + Intergenic
940736350 2:157457211-157457233 CTGTGTTCCCTGAACAAACATGG + Intronic
945138092 2:206651695-206651717 GTGTGAACTATGAAGAAAACAGG - Exonic
947433401 2:230050926-230050948 CTGGGTATCCTCATGAAAACAGG - Intronic
1170121922 20:12921449-12921471 CTGGGAACCCTGAGGAATACTGG - Intergenic
1170332740 20:15232956-15232978 CTGTGTACCCTGACGTTATCAGG + Intronic
1170848439 20:19981933-19981955 CTCTTTACCCTGCAGAATACAGG - Intronic
1171163290 20:22948003-22948025 CTTTGTAGCATGAAGTAAACAGG - Intergenic
1171438020 20:25138894-25138916 CTCTGTCCCCTGAAGAGCACTGG + Intergenic
1173376947 20:42494093-42494115 CTCTTTACTCTGAAAAAAACAGG - Intronic
1173792575 20:45837235-45837257 CAGTGTGTCCTGAAGAAAACTGG + Intronic
1176511651 21:7752912-7752934 ATGTGAACCTTCAAGAAAACAGG + Intronic
1176885616 21:14251723-14251745 TTCTTTACCCTGTAGAAAACAGG + Intergenic
1178645765 21:34383440-34383462 ATGTGAACCTTCAAGAAAACAGG + Intronic
949322956 3:2832136-2832158 CTGTGTCCATTGAAGTAAACTGG - Intronic
952075256 3:29688259-29688281 CTCTCTACCCTCAAGAAAATGGG - Intronic
954134798 3:48576998-48577020 CTGGGGACCCTGGAGAAGACGGG - Exonic
954212610 3:49106592-49106614 CAGTGTACCATGAAGTAACCAGG - Intergenic
955378577 3:58418455-58418477 CAGCGCACCCTGAAGAAAGCAGG - Intronic
957169643 3:76721960-76721982 CTGTCTGCCATGAAGAAATCAGG + Intronic
962116974 3:132520348-132520370 CTGAGTAACCTGAACATAACTGG + Intronic
963544213 3:146634431-146634453 CTGTGTGAACTGAAGAAAAGAGG - Intergenic
964465441 3:156986569-156986591 CTGTCTACCCTGATGCAAAAAGG - Intronic
964467531 3:157012638-157012660 CTGTGTACCCTGATGGACAAGGG - Intronic
964650738 3:159008670-159008692 CTGTACACACTGAAGAAAGCTGG + Intronic
964981847 3:162692545-162692567 CTATGTACTTTGAAGAAAAGGGG - Intergenic
965090494 3:164156328-164156350 CTGTGTAACCTGGATCAAACTGG + Intergenic
966114146 3:176441196-176441218 CTCTGTGCCCTGAAGATAATGGG + Intergenic
968779672 4:2570956-2570978 GTGTGAACCCTGAATACAACAGG - Intronic
971553606 4:27983478-27983500 CTGAATTCCCTCAAGAAAACTGG + Intergenic
971675487 4:29621758-29621780 GTGTTTTCCCTGAAAAAAACTGG - Intergenic
972443266 4:39117594-39117616 GTGTGGTCTCTGAAGAAAACAGG + Intronic
972544384 4:40066227-40066249 CTGGGTCCCCTGAAAAAAATGGG - Intronic
974148839 4:57979664-57979686 CAGTGTAGCCTGAAAAAAACTGG - Intergenic
974172430 4:58283013-58283035 GTGTGTTCTCTGAAGAACACTGG + Intergenic
974509908 4:62825625-62825647 CTGCCTACCATGAAGAAAAGAGG - Intergenic
977196028 4:94061178-94061200 CTGTGTATCCTGAAGTATATAGG - Intergenic
979917989 4:126462879-126462901 ATGTATACCCAGAAGAAAATTGG - Intergenic
979990467 4:127368975-127368997 CTGAATACACAGAAGAAAACAGG + Intergenic
980073316 4:128265977-128265999 CTGGGCACCTTGAAAAAAACAGG - Intergenic
983106496 4:163692769-163692791 GTCTGTTCCCTGTAGAAAACTGG + Intronic
983964864 4:173797825-173797847 ATGTATACCCTGAGGAAAAGGGG - Intergenic
985626753 5:992956-992978 CTGTGTGCCCTGAGTAACACGGG + Intergenic
990417601 5:55601052-55601074 CTGAGTTCCTTGAAGAAACCGGG + Intergenic
990885284 5:60584721-60584743 CTGTGTACCCTGCACACTACAGG + Intergenic
992869257 5:80990103-80990125 CTGTGTCCCCTGGAGAAAGTAGG + Intronic
992910204 5:81389094-81389116 CTAAGTGCTCTGAAGAAAACAGG + Intronic
993539494 5:89130988-89131010 CTGTGTAAACTGGTGAAAACAGG - Intergenic
997639027 5:135436514-135436536 GTGTGTACCCTGAGGAAGATTGG + Intergenic
998556848 5:143133909-143133931 CTGTGGACTGGGAAGAAAACAGG - Intronic
999117248 5:149174671-149174693 CAGTGTATCCTGAAGGAAAGAGG - Intronic
999459580 5:151746356-151746378 CTTGCAACCCTGAAGAAAACAGG - Exonic
1000353069 5:160367741-160367763 CTGTGGACACTGTAGAACACAGG - Intronic
1001349217 5:170940794-170940816 CCATGTGCCCTGGAGAAAACTGG - Intronic
1003140840 6:3469889-3469911 CTTTATTCCCTGAACAAAACAGG + Intergenic
1005410546 6:25540775-25540797 TTGTGTTCTCAGAAGAAAACAGG - Intronic
1006434307 6:34018375-34018397 CTGTGTACTTTGAAGCGAACTGG + Intergenic
1008000259 6:46352746-46352768 CTGAGTACCCTGGAGGAATCAGG + Intronic
1008662251 6:53680170-53680192 CTGTGTGCCCGGCTGAAAACTGG - Intergenic
1009925821 6:70119492-70119514 GTGTGTACCCTAGAGAATACTGG - Intronic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1012347671 6:98211383-98211405 CTGTAAAACTTGAAGAAAACAGG + Intergenic
1013215776 6:108025983-108026005 CTGTGTCCCCCGAAGACAATTGG - Intergenic
1013341614 6:109221279-109221301 GTGAGTGCCATGAAGAAAACAGG + Intergenic
1013603079 6:111723116-111723138 ATAAGAACCCTGAAGAAAACAGG + Intronic
1014747686 6:125219195-125219217 CTGGGTTCCCTGGAGAACACAGG + Intronic
1014964217 6:127726600-127726622 CTATTTTCCCTGATGAAAACTGG + Intronic
1015471084 6:133607203-133607225 CTGCATTCCCTTAAGAAAACTGG + Intergenic
1018061246 6:160091522-160091544 CTGTGGCCCCTGAATAGAACTGG + Intronic
1020378883 7:7520107-7520129 ATGTGTACCCTGAAGGCAAAGGG + Exonic
1021159886 7:17259811-17259833 CTGTGTGCCCTGAGGGAGACAGG - Intergenic
1023572047 7:41582366-41582388 GTTTGTACCCTGAAAAAATCTGG + Intergenic
1025235385 7:57231318-57231340 CAGTGGACCCTGAACAACACAGG - Intergenic
1026286403 7:68967055-68967077 CTTTGGAGCCAGAAGAAAACAGG + Intergenic
1027840304 7:83302030-83302052 ATGTGAACACTGAAGAAAATTGG + Intergenic
1028128337 7:87140942-87140964 ATGAGAACCCTGATGAAAACTGG + Intergenic
1039721753 8:40172305-40172327 CTGTGTTCCCTGGAGAAGACAGG - Intergenic
1041503826 8:58571435-58571457 CTCTGAACCTTGAAGAAAAAGGG - Intronic
1044950393 8:97430404-97430426 CTGTGTCTCCTGAAGAATAGTGG - Intergenic
1045274794 8:100693714-100693736 ATGCATACCCTGAAGAAAAATGG + Intronic
1046084758 8:109418349-109418371 TTATGAACCCTGAAGAAAATGGG + Intronic
1047816971 8:128475284-128475306 CAGTGTTCCCAGAAGAAACCAGG + Intergenic
1048706807 8:137162769-137162791 ATGGGTATCCTGAAGAAACCAGG - Intergenic
1049738026 8:144220446-144220468 ATTTGTCCCCTGAAGAAAAGTGG + Intronic
1050341973 9:4649214-4649236 CTGTCTACCCAGAGGAAAAGAGG - Intronic
1051024900 9:12596674-12596696 ATGTGTAGTCTGAAGGAAACAGG - Intergenic
1052012863 9:23431693-23431715 CTGTGTTCCCAGAAGAGAGCAGG + Intergenic
1056943383 9:90974120-90974142 CAGTGTACCATGAAGATGACTGG - Intergenic
1057007777 9:91575778-91575800 CTCTGTACCCAAAAGAAAATTGG + Intronic
1057130129 9:92649116-92649138 CTGTGCCCTCTGAGGAAAACGGG + Intronic
1057402960 9:94740786-94740808 CTGTGTAACCTTAAGCAAGCTGG + Intronic
1058803224 9:108565231-108565253 CTGTGTACCCAGGAGCAATCTGG - Intergenic
1059055214 9:110972213-110972235 CTGTGTACCTGGAAAACAACAGG + Exonic
1059895027 9:118854654-118854676 CTCTGTTTCCTGAAGACAACAGG + Intergenic
1061234872 9:129336535-129336557 CTGTGTGCCCTGTAGTAAAAGGG - Intergenic
1061482773 9:130905271-130905293 CCGTGGACCCTGAGGAAGACGGG - Exonic
1061629367 9:131862273-131862295 CTTTCTAGCATGAAGAAAACAGG + Intronic
1062731342 9:138111808-138111830 CTGTGTGCCCTGAAGGTAAAAGG - Intronic
1187895107 X:23973437-23973459 GCATGTACCCTGAAGACAACAGG + Intergenic
1187913831 X:24134714-24134736 GCATGTACCCTGAAGACAACAGG + Intergenic
1189101746 X:38197716-38197738 ATTTGTAGCCTGAAGAAAATGGG + Intronic
1189439124 X:41018716-41018738 CTGTGGTCCCTGAAGACAATTGG - Intergenic
1189604569 X:42662318-42662340 GTGTGGACCCAGAGGAAAACTGG - Intergenic
1189658071 X:43267679-43267701 CTGTGTAGCCTGGAGCACACAGG + Intergenic
1192201341 X:69068575-69068597 CTGTGGGCCCTGAAGGAAAAAGG - Intergenic
1194047159 X:89022896-89022918 CTATATACCCTAAAGAAAATAGG - Intergenic
1198884988 X:141325276-141325298 CATTTTAACCTGAAGAAAACAGG - Intergenic
1199426103 X:147702828-147702850 CTGAGAACCCTGAGGAAAAAGGG - Intergenic