ID: 1075353209

View in Genome Browser
Species Human (GRCh38)
Location 10:121744940-121744962
Sequence GCCATGAAGTCCAACGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075353209_1075353214 8 Left 1075353209 10:121744940-121744962 CCTGGAACGTTGGACTTCATGGC No data
Right 1075353214 10:121744971-121744993 TACCCTCCACCTTGGAGTTTTGG No data
1075353209_1075353215 9 Left 1075353209 10:121744940-121744962 CCTGGAACGTTGGACTTCATGGC No data
Right 1075353215 10:121744972-121744994 ACCCTCCACCTTGGAGTTTTGGG No data
1075353209_1075353211 0 Left 1075353209 10:121744940-121744962 CCTGGAACGTTGGACTTCATGGC No data
Right 1075353211 10:121744963-121744985 AGGATCCCTACCCTCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075353209 Original CRISPR GCCATGAAGTCCAACGTTCC AGG (reversed) Intronic