ID: 1075353209

View in Genome Browser
Species Human (GRCh38)
Location 10:121744940-121744962
Sequence GCCATGAAGTCCAACGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075353209_1075353214 8 Left 1075353209 10:121744940-121744962 CCTGGAACGTTGGACTTCATGGC 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1075353214 10:121744971-121744993 TACCCTCCACCTTGGAGTTTTGG No data
1075353209_1075353211 0 Left 1075353209 10:121744940-121744962 CCTGGAACGTTGGACTTCATGGC 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1075353211 10:121744963-121744985 AGGATCCCTACCCTCCACCTTGG No data
1075353209_1075353215 9 Left 1075353209 10:121744940-121744962 CCTGGAACGTTGGACTTCATGGC 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1075353215 10:121744972-121744994 ACCCTCCACCTTGGAGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075353209 Original CRISPR GCCATGAAGTCCAACGTTCC AGG (reversed) Intronic
904274480 1:29371320-29371342 TCCATAAAGTCCAAATTTCCTGG + Intergenic
904423541 1:30409254-30409276 TCCATAAAGTCCAAATTTCCTGG - Intergenic
917500229 1:175578919-175578941 GCCATGACATCCAGGGTTCCTGG - Intronic
1065457765 10:25925544-25925566 GCTATGATGTCCAATGTCCCAGG - Intergenic
1066957980 10:42191086-42191108 GCCATGGAGTCCAATGTTTGAGG + Intergenic
1070171740 10:73938119-73938141 GCCAGGGAGTCCAAAGTTACTGG - Intergenic
1074839415 10:117334224-117334246 GGCATGAAGCCCAACATTACAGG - Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1088392692 11:109332604-109332626 TTCATGAAGTCCCAAGTTCCAGG + Intergenic
1089912465 11:122115675-122115697 GCCATGAAGCGGAATGTTCCTGG - Exonic
1095503625 12:42868265-42868287 CCCATGAACTCCAACGTGCAAGG - Intergenic
1095565982 12:43623509-43623531 GACATGAAGTCCAACTTACAAGG + Intergenic
1096660958 12:53123724-53123746 ATCATGAAGTTCAACATTCCTGG - Exonic
1110728531 13:78853354-78853376 CCCATGAAGACCAAAGTTCTAGG + Intergenic
1114917445 14:27286102-27286124 AACATCAAGTCCAAGGTTCCAGG - Intergenic
1121742221 14:96262157-96262179 TCCATGCAGACCAAGGTTCCTGG + Intronic
1202935134 14_KI270725v1_random:80809-80831 GCCATGGAGTCCAATGTTTGAGG - Intergenic
1125448602 15:39784310-39784332 GCCATGAAAGCCTATGTTCCTGG + Intergenic
1129764302 15:78151675-78151697 GACCTGAAGTCCAAAGTTCAGGG + Intronic
1134665245 16:16013943-16013965 GCCCTGATGCTCAACGTTCCCGG - Intronic
1147538507 17:41336130-41336152 ACCATGATGTCCCACCTTCCCGG + Intergenic
1148969835 17:51470124-51470146 GCAATGTAGTCTCACGTTCCAGG + Intergenic
1154491759 18:14927697-14927719 CCCATAAACTCCAAAGTTCCTGG + Intergenic
1157377317 18:47178293-47178315 AACTTGAAGTCCAACGTTCAAGG - Intergenic
926551929 2:14311428-14311450 GCCAAGAAGTCCAAGGTTGAGGG + Intergenic
934306100 2:91823477-91823499 GCCATGGAGTCCAATGTTTGAGG + Intergenic
934327156 2:92029265-92029287 GCCATGGAGTCCAATGTTTGAGG - Intergenic
934465539 2:94259835-94259857 GCCATGGAGTCCAATGTTTGAGG - Intergenic
937111566 2:119370745-119370767 CCCGTGAAGTCCAACATCCCGGG - Exonic
937759968 2:125589415-125589437 GCCATGAAGTGTAAGCTTCCAGG - Intergenic
938166451 2:129031646-129031668 GCCATGAAGTCTAATTTGCCTGG - Intergenic
946039666 2:216772987-216773009 TCCATGTAATCCAACCTTCCTGG + Intergenic
1173653490 20:44682722-44682744 GACCTGAAGTCCAATGATCCTGG + Intergenic
1176596555 21:8703037-8703059 GCCATGGAGTCCAATGTTTGAGG - Intergenic
1177770431 21:25508615-25508637 GCACTGAAGTCCCACATTCCAGG + Intergenic
1179667569 21:42923176-42923198 GCAATGAAGGCCACCGGTCCAGG - Intergenic
1180279469 22:10680483-10680505 GCCATGGAGTCCAATGTTTGAGG - Intergenic
1180586681 22:16899018-16899040 GCCATGGAGTCCAATGTTTGAGG - Intergenic
1181165850 22:20982568-20982590 CCCATGAAGCCCACCGTACCGGG - Exonic
1182802585 22:33043584-33043606 GCCATGAAGTCAAAACTACCTGG + Intronic
1183456641 22:37926597-37926619 GCCAAAAACTCCAGCGTTCCTGG - Intronic
1184631299 22:45782348-45782370 GCCATGAACACAAACGTTCATGG + Intronic
957410925 3:79838605-79838627 GCCAAGAAGTCCAAAGTTGAGGG - Intergenic
962036028 3:131652797-131652819 GCCATGTTGTCCAACTGTCCTGG + Intronic
963785072 3:149526222-149526244 GCCATGCTGCCCAACTTTCCAGG + Intronic
970782494 4:19755280-19755302 GCCATGAAGTCAAACATTCTAGG + Intergenic
972964729 4:44495411-44495433 AACATGGAGTCCAATGTTCCAGG + Intergenic
973287389 4:48433731-48433753 GCCCAGAAGTCCAAGGTTACAGG - Intergenic
975253381 4:72206010-72206032 GCCATGAAATTCCACATTCCTGG - Intergenic
978443865 4:108762631-108762653 GGCAGGAAGCCCAGCGTTCCGGG + Intronic
982787277 4:159550436-159550458 GCTATGAAGTCCAAGGTTGAGGG + Intergenic
984045572 4:174793527-174793549 GCCCAGAAGTTCAACGTTGCGGG - Intronic
987414288 5:17647099-17647121 CCCAGGAAGTCTAAGGTTCCAGG + Intergenic
990617974 5:57526869-57526891 GCCATGAAATCCACCTTTTCAGG - Intergenic
1002554942 5:180029652-180029674 GCCATGTAGTCCAACGTAGCTGG + Intronic
1004246856 6:13986342-13986364 GCCAGGAAGTCCTCCTTTCCTGG - Intergenic
1019338989 7:499443-499465 ACCATGGAGTCCCACGTGCCAGG + Intronic
1019927066 7:4200229-4200251 ACCATGAAATCCAACATTCATGG + Intronic
1023677629 7:42646992-42647014 GCCAGGAAGTCCAAGGTTGAGGG - Intergenic
1024775717 7:52783252-52783274 GCAATGAAGACAAATGTTCCAGG + Intergenic
1029209409 7:98893530-98893552 GCCATGAAGTCCTTAGCTCCTGG + Intronic
1043682616 8:83048708-83048730 GCCATTGAGTCCAAAGTTCAGGG + Intergenic
1044673672 8:94708933-94708955 GCCATGAATTCATAGGTTCCAGG + Intergenic
1048307437 8:133294197-133294219 GCTCTGAAGTCCAACTGTCCGGG + Intronic
1051051714 9:12941251-12941273 GCAATGAAGTCCAATGATCAAGG + Intergenic
1053695603 9:40636613-40636635 GCCATGGAGTCCAATGTTTGAGG - Intergenic
1053942593 9:43267656-43267678 GCCATGGAGTCCAATGTTTGAGG - Intergenic
1054306850 9:63435835-63435857 GCCATGGAGTCCAATGTTTGAGG - Intergenic
1054405581 9:64759825-64759847 GCCATGGAGTCCAATGTTTGAGG - Intergenic
1056165464 9:83936862-83936884 GACATGAACTCCTACGTTCAAGG + Intergenic
1057536975 9:95919682-95919704 GCCATGAAAGCCATCATTCCTGG + Intronic
1059058998 9:111015196-111015218 GCCATGAAGTCCCACGGACTGGG - Intronic
1202778048 9_KI270717v1_random:10229-10251 GCCATGGAGTCCAATGTTTGAGG - Intergenic
1194812068 X:98399283-98399305 GCCAGGAAGTCCAAAGATCAAGG + Intergenic
1198979820 X:142381976-142381998 GCAATGAAGACTAACTTTCCCGG - Intergenic