ID: 1075353209 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:121744940-121744962 |
| Sequence | GCCATGAAGTCCAACGTTCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1075353209_1075353214 | 8 | Left | 1075353209 | 10:121744940-121744962 | CCTGGAACGTTGGACTTCATGGC | No data | ||
| Right | 1075353214 | 10:121744971-121744993 | TACCCTCCACCTTGGAGTTTTGG | No data | ||||
| 1075353209_1075353215 | 9 | Left | 1075353209 | 10:121744940-121744962 | CCTGGAACGTTGGACTTCATGGC | No data | ||
| Right | 1075353215 | 10:121744972-121744994 | ACCCTCCACCTTGGAGTTTTGGG | No data | ||||
| 1075353209_1075353211 | 0 | Left | 1075353209 | 10:121744940-121744962 | CCTGGAACGTTGGACTTCATGGC | No data | ||
| Right | 1075353211 | 10:121744963-121744985 | AGGATCCCTACCCTCCACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1075353209 | Original CRISPR | GCCATGAAGTCCAACGTTCC AGG (reversed) | Intronic | ||