ID: 1075353211

View in Genome Browser
Species Human (GRCh38)
Location 10:121744963-121744985
Sequence AGGATCCCTACCCTCCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075353206_1075353211 14 Left 1075353206 10:121744926-121744948 CCTTCATTCTGCTGCCTGGAACG No data
Right 1075353211 10:121744963-121744985 AGGATCCCTACCCTCCACCTTGG No data
1075353209_1075353211 0 Left 1075353209 10:121744940-121744962 CCTGGAACGTTGGACTTCATGGC 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1075353211 10:121744963-121744985 AGGATCCCTACCCTCCACCTTGG No data
1075353204_1075353211 19 Left 1075353204 10:121744921-121744943 CCTTTCCTTCATTCTGCTGCCTG No data
Right 1075353211 10:121744963-121744985 AGGATCCCTACCCTCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075353211 Original CRISPR AGGATCCCTACCCTCCACCT TGG Intronic
No off target data available for this crispr