ID: 1075358097

View in Genome Browser
Species Human (GRCh38)
Location 10:121802144-121802166
Sequence GACTGGAGAGCTTTGGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075358097_1075358101 12 Left 1075358097 10:121802144-121802166 CCTTTTGCCAAAGCTCTCCAGTC 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1075358101 10:121802179-121802201 GTACCATGTATCTGAGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075358097 Original CRISPR GACTGGAGAGCTTTGGCAAA AGG (reversed) Intronic
904957653 1:34298591-34298613 GACTGGAGAAATTGAGCAAAGGG - Intergenic
906236606 1:44214949-44214971 GACTGGAGAGCTCGCACAAATGG - Intronic
913440811 1:118895267-118895289 GAATGGAGAGCTTTTGTAAATGG + Intronic
915346039 1:155197408-155197430 CAGAGGAGAGCTTTGGGAAAGGG + Intronic
916119597 1:161516838-161516860 GTTTGCAGAGCTTTGGAAAAGGG - Intronic
916129360 1:161598493-161598515 GTTTGCAGAGCTTTGGAAAAGGG - Intronic
918466127 1:184823241-184823263 GAATGCAGAGCTCTGACAAAGGG - Exonic
919880186 1:201895941-201895963 GCCTGGTGAGCTTCGGAAAAGGG - Intergenic
920038403 1:203080530-203080552 GAGTGGGGACCTGTGGCAAAGGG + Intergenic
920132185 1:203740921-203740943 CCCTGGAGAGCCTTGGCAGATGG - Exonic
920698736 1:208201814-208201836 GAGTGCAGAGCTTGGGCACATGG - Intronic
921294823 1:213691866-213691888 GGCTGGAGAGCTTTCCCAAAGGG + Intergenic
922994949 1:229948660-229948682 GGCTGGATAGCTTTGGCTCATGG - Intergenic
923236195 1:232035577-232035599 GAATGGGGAGCTTTGGGAAAGGG - Intronic
924579719 1:245313373-245313395 GACTGAAGAGCTTTGTCGAAAGG + Intronic
1069899116 10:71696850-71696872 GCCTAGAGAGCTGTGTCAAAGGG - Intronic
1070662253 10:78315482-78315504 GAGTGGTGGGCTTTGGCAGATGG + Intergenic
1073232961 10:101988027-101988049 AACTGGATAGTTTTGGCATAGGG - Intronic
1073750897 10:106526161-106526183 GAATGAAGAGCTTTGGGAAAAGG - Intergenic
1075171899 10:120123135-120123157 GACTGGAGAGTGATGGAAAATGG + Intergenic
1075358097 10:121802144-121802166 GACTGGAGAGCTTTGGCAAAAGG - Intronic
1078679283 11:13460695-13460717 GATTGGAGGGGTTTGGCAACAGG - Intronic
1080822435 11:35820216-35820238 GAATAGAGAGCTTGGGCAAAAGG - Intergenic
1081956105 11:47095340-47095362 GACTGGAGAGCAAAGGAAAAAGG - Intronic
1082122264 11:48391898-48391920 CACTGGAGAGTGTTGGAAAATGG - Intergenic
1083441137 11:62677409-62677431 GAAGGGAGAGATTTGGCAAAGGG + Intronic
1085673125 11:78488173-78488195 GCATGGACAGCTTTGGCAGAGGG - Intronic
1088878815 11:113957767-113957789 GACTGGAGAGTTCTGGCTGAAGG + Intergenic
1090152973 11:124404570-124404592 GGCTGCAGAGCTTTGGGACAAGG - Intergenic
1090431801 11:126652554-126652576 GAGTGGAGGACTTTGGCAAATGG - Intronic
1092090994 12:5803609-5803631 CACTAGGCAGCTTTGGCAAATGG + Intronic
1092787314 12:12038938-12038960 GACTGAAAAGATTTGACAAACGG + Intergenic
1094019444 12:25898419-25898441 GACTGCAGAGGTTTAGCAATAGG - Intergenic
1095630589 12:44372457-44372479 GAGTGGAGAGATTTGACTAATGG - Intronic
1096595075 12:52689972-52689994 GACTAGAGAGGTCTGGGAAAGGG + Exonic
1098242841 12:68486116-68486138 GACAGGAGGGCATTGGCATAAGG + Intergenic
1099923984 12:88994746-88994768 GAATGCAGGGCTTTGGCAACTGG - Intergenic
1101451318 12:104781567-104781589 CACTGGAGAGCTTTGAGCAAAGG + Intergenic
1103055518 12:117817090-117817112 TTCTGGAAAGATTTGGCAAAAGG - Intronic
1104598978 12:130139623-130139645 GGCAGGAGGGCTTTGGAAAAGGG - Intergenic
1104802696 12:131565542-131565564 GTCCGGAGAGCTTTGTCATATGG + Intergenic
1105073944 12:133258951-133258973 GACTGGATTGCTTTGGTCAAAGG + Intergenic
1105772068 13:23621213-23621235 GACCAGAGAGCTGAGGCAAAGGG - Intronic
1106110307 13:26771375-26771397 CATTGGAGAGTTTTGGCCAAGGG - Intergenic
1106808141 13:33332426-33332448 GAGAGGAGAGCTCTGGTAAATGG + Intronic
1108344715 13:49534184-49534206 GACTGCAGCATTTTGGCAAATGG - Exonic
1112518439 13:100076343-100076365 GACTGGCCAGATTTGGCCAAGGG - Intergenic
1113117128 13:106885485-106885507 GACTGCAGAGCATTGCAAAATGG + Intergenic
1119821286 14:77618197-77618219 GGCTGGAGAGATTAGGCAACAGG + Intergenic
1121575446 14:94981224-94981246 CACTGGGGAGCTCTGGAAAATGG + Intergenic
1121972478 14:98370904-98370926 GAATGTAGAGATTTGGCATAAGG + Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1122939541 14:104975084-104975106 GACAGAAGAGCTTGGCCAAATGG + Intronic
1125171823 15:36773901-36773923 GACTGGAGACATTTGCCAAGTGG - Intronic
1126278441 15:46913823-46913845 GACTGGAGGGGTGTGGGAAATGG + Intergenic
1127207060 15:56732639-56732661 CACGGGAGACCTTTGGCCAAAGG - Intronic
1130788228 15:87123626-87123648 GAAGGTACAGCTTTGGCAAAAGG - Intergenic
1134620678 16:15686887-15686909 GCCTGGCAAGCTTGGGCAAATGG - Intronic
1139267821 16:65656487-65656509 GACTGGGGAGCTTAGGCAGCAGG - Intergenic
1139629666 16:68221797-68221819 AACAGCAGAGCTTTGGCAAGGGG + Intronic
1140041775 16:71412939-71412961 GGGTGGAGAACTTTAGCAAATGG - Intergenic
1140278006 16:73528114-73528136 TCCTGGAGAGCTTTGACATATGG + Intergenic
1140525404 16:75618749-75618771 TCCTGGAGAGCTTTGCCAGAAGG + Intronic
1143854077 17:9835507-9835529 AAATGGAGAGATATGGCAAATGG + Intronic
1144577554 17:16438642-16438664 GCCTGTAGAGCTGTGGCACAAGG - Intergenic
1144860916 17:18301357-18301379 GGCTGGAGAGATTAGGGAAAGGG - Intronic
1145853171 17:28123984-28124006 AACTCGAGAACTTTGGCCAAAGG + Intronic
1147670792 17:42175757-42175779 TACTGGGGGGCCTTGGCAAAGGG + Intronic
1149220542 17:54411862-54411884 GACTGTAGAGCTCTGGCCTAAGG + Intergenic
1152239600 17:79154549-79154571 GACTGGAGAGGTCTGGCTGAGGG + Intronic
1152431133 17:80248757-80248779 GACTGGAGAGCGTTGGGGACAGG - Intronic
1160064167 18:75559655-75559677 CCCTGCAGAGCCTTGGCAAATGG + Intergenic
1164434749 19:28219539-28219561 CTCTGGAGAGCTTTGGCCATGGG + Intergenic
1164877448 19:31701336-31701358 GCCTGGAGAGCTCTGGCCAAGGG + Intergenic
1168598861 19:57701917-57701939 GAGTGCAGACCTTTGGCTAAAGG + Exonic
1168598893 19:57702169-57702191 GAGTGCAGACCTTTGGCTAAAGG + Exonic
928876666 2:36047937-36047959 GAGTGTAGAGCTTTGCTAAAGGG - Intergenic
930610567 2:53538618-53538640 GACTGGAGATGTTTGCCAGAAGG - Intronic
931942795 2:67271568-67271590 GATTGGAGACTTTTGCCAAATGG - Intergenic
934162733 2:89267846-89267868 CACTGGAGAGTTTTTGTAAAAGG - Intergenic
934204542 2:89914678-89914700 CACTGGAGAGTTTTTGTAAAAGG + Intergenic
934818970 2:97355466-97355488 CACTGGAAAGTTTTGGCAGAAGG + Intergenic
935476398 2:103528674-103528696 GAGGTCAGAGCTTTGGCAAAAGG - Intergenic
936447029 2:112604251-112604273 GACTCCTGAGCTGTGGCAAATGG + Intergenic
939865960 2:147472801-147472823 CTCTGGATAGCTTTAGCAAAAGG + Intergenic
943372841 2:187037077-187037099 GACTGGATTGCTTTGGTCAAAGG - Intergenic
944217486 2:197270653-197270675 GACTGGAGGCCCTTGGGAAATGG - Intronic
944365176 2:198910874-198910896 AACGGGAGATGTTTGGCAAAGGG - Intergenic
944891904 2:204126665-204126687 GACCGGAGAGCTATGGCCACAGG + Intergenic
948423051 2:237872287-237872309 GAGTGGACGACTTTGGCAAAGGG - Intronic
948538955 2:238672061-238672083 AACTGTAGAGCAGTGGCAAAAGG - Intergenic
1171940963 20:31329517-31329539 GATGGAAGAGGTTTGGCAAATGG - Intergenic
1172550178 20:35793019-35793041 CACGGCAGAACTTTGGCAAAAGG + Intronic
1174254142 20:49241889-49241911 TCCTGCAGAGCTTTGGCAACTGG - Exonic
1175599793 20:60263928-60263950 GAATGAAGAGCTTTGTCAATTGG + Intergenic
1182287812 22:29258668-29258690 GGCTGCAGAGCTGTGGGAAAGGG - Intronic
1183063026 22:35347095-35347117 GGCTGGAGAGGTTGGGCAATCGG - Exonic
1184201761 22:42974381-42974403 GAATGGAAATCATTGGCAAAGGG - Intronic
950916378 3:16650131-16650153 GCTTGCAGAGCTTTGGGAAAAGG - Intronic
953182134 3:40605707-40605729 GGCTGCAGAGCTTTGGAATAAGG - Intergenic
954004550 3:47580343-47580365 GTCTGGAGAGCCTTGAAAAAAGG + Exonic
955973249 3:64456874-64456896 CCCTGGAGAGCTTTTGTAAAAGG - Intergenic
956595896 3:70966700-70966722 GACTAAAGAACTCTGGCAAAGGG + Intronic
956780851 3:72601933-72601955 GCCTGAAGGGCTTTGGTAAAAGG - Intergenic
959086251 3:101853460-101853482 GACTGGGGAGGTATGGGAAAAGG - Exonic
960889680 3:122434429-122434451 GACTAGAGAGTTTTCGCACATGG - Intronic
961709270 3:128814706-128814728 GAATGTAGACCTTTGGAAAAAGG - Exonic
962144361 3:132824499-132824521 TACAAGAGAGCTTTGGAAAAGGG + Intergenic
963301106 3:143598046-143598068 GACTGGAGAGCTCAGGGAATTGG - Intronic
965996481 3:174889131-174889153 GACTGAGGGGCTTAGGCAAAGGG - Intronic
968987548 4:3884995-3885017 GAGTGGAGAGCTTGGTGAAAGGG - Intergenic
969023189 4:4152164-4152186 GAGTGGAGAGCTTGGTGAAAGGG - Intergenic
969238044 4:5880598-5880620 GAATGGGAAGCTTTTGCAAAAGG - Intronic
969730621 4:8954917-8954939 GAGTGGAGAGCTTGGTGAAAGGG + Intergenic
972993263 4:44848668-44848690 GACTTGAGGGCTTTAGCAGATGG - Intergenic
973012940 4:45099684-45099706 TATTGGACAGCTTTGCCAAAAGG - Intergenic
973259325 4:48145494-48145516 GAGTGGTGAGGCTTGGCAAATGG - Exonic
978541461 4:109820646-109820668 GACTGCTCAGCTATGGCAAAAGG + Intronic
979417891 4:120465506-120465528 GACTGGGGAAATCTGGCAAAGGG + Intergenic
980142703 4:128939658-128939680 AAATGGAGAGCCCTGGCAAAAGG + Intronic
980243591 4:130207676-130207698 TACTGGATATCTTTGCCAAATGG + Intergenic
980645007 4:135632782-135632804 TACTGGAGAGTGTTTGCAAAGGG + Intergenic
981238340 4:142444255-142444277 GACAGTAGACCTTTGTCAAATGG + Intronic
983204979 4:164902417-164902439 GAGTGGAGAGATTTGGGAACAGG + Intergenic
983585077 4:169345645-169345667 GACAGGAGAGTTTTGCCAACAGG + Intergenic
984592657 4:181633768-181633790 GCCTGGAGTGCTTTAGCACACGG + Intergenic
989123529 5:38028504-38028526 GACTTGAGACCTTTAGCAAATGG - Intergenic
989236609 5:39155211-39155233 AAGTGAAGAGCTTTGGCAAGAGG - Intronic
989432455 5:41371703-41371725 GCCTGGGGATCTTTGGCTAAAGG + Intronic
990291789 5:54359616-54359638 GAAAGAAGAGCTTAGGCAAAAGG + Intergenic
990808361 5:59692811-59692833 GACTTGTGACCTTAGGCAAATGG + Intronic
995035750 5:107532243-107532265 TAGTGGAGAGCTTTGACTAAAGG + Intronic
996107449 5:119521027-119521049 GACTAAGAAGCTTTGGCAAAAGG - Intronic
996512836 5:124336653-124336675 GTTTGGAGAGATTTGGCATAAGG - Intergenic
997460981 5:134052232-134052254 GAGTGGAGAGTTGTGGGAAAAGG - Intergenic
997733718 5:136198646-136198668 GGCTGGTGAGCCTTTGCAAAAGG + Intergenic
999319284 5:150603377-150603399 GACTGGGGAGCTTTGCCAAGGGG - Intronic
1006306697 6:33225680-33225702 GATTGGAGAGCTTTAGTCAAAGG + Intergenic
1006379090 6:33687465-33687487 GCCTGGAGAGCTGAGGGAAATGG - Exonic
1007339932 6:41184936-41184958 GACTGGGGGGCTTTGGAATAAGG + Intergenic
1007693717 6:43718661-43718683 CACTTGAGAGCTGTGGGAAATGG + Intergenic
1007773360 6:44208761-44208783 GACTGCAGAGTTCTGGCAATGGG - Intergenic
1009412044 6:63377409-63377431 GTTTGGAGAGCTGGGGCAAAAGG - Intergenic
1009988730 6:70814457-70814479 GTCTTGAGAGCATTGGCACAGGG - Intronic
1010284826 6:74064118-74064140 GATGTGAGAGCGTTGGCAAATGG + Intergenic
1010654509 6:78496231-78496253 GAATGGAAAGCTTCAGCAAATGG + Intergenic
1013304487 6:108835625-108835647 GAGTGGAGATTTTTGGGAAAAGG - Intergenic
1013866257 6:114700259-114700281 GGCTTGTGAGCTTTGGCAAAAGG - Intergenic
1016096686 6:140045997-140046019 GACTGGGGATCTATGGGAAAGGG + Intergenic
1019559917 7:1650892-1650914 GAGCGGGGTGCTTTGGCAAAAGG - Intergenic
1023654469 7:42406031-42406053 GACTGGTGTGCTTTGGCAATGGG + Intergenic
1023785648 7:43705399-43705421 CATTGGAGTGCTTTTGCAAATGG - Intronic
1024953046 7:54885004-54885026 GAGTGGAGAGTAGTGGCAAAAGG - Intergenic
1027712706 7:81626190-81626212 GACTGGAGAGGTTTTGCAACAGG - Intergenic
1028724737 7:94074429-94074451 GACTGAAGAGCAGTGGCAAATGG + Intergenic
1029935011 7:104415274-104415296 GACTTGAGAGCTTGGTTAAATGG + Intronic
1030262063 7:107576387-107576409 AACTGTAGATCTTTGTCAAAAGG + Exonic
1030411910 7:109191564-109191586 CAATGAAGAGCTTTGCCAAATGG - Intergenic
1030583739 7:111391240-111391262 GAGTGGAGAGCCTTGACTAATGG - Intronic
1031159582 7:118150260-118150282 CACTGGAGAGTTTGGGCAGAAGG + Intergenic
1032282798 7:130518421-130518443 AACTGGAGAGCATGGGCAAGTGG + Intronic
1033899106 7:146114766-146114788 TACTGGAGTGTTTTGGCAAGTGG + Intergenic
1034414401 7:150957065-150957087 GACTGGAGAGGTCTGGTAAAGGG - Intronic
1034726319 7:153339521-153339543 GAGTGGAGAGGGATGGCAAAAGG + Intergenic
1035494708 7:159314167-159314189 GACTGGATTGCTTTGGTCAAAGG + Intergenic
1037737189 8:21577347-21577369 CAAAGGAGAACTTTGGCAAAGGG - Intergenic
1037902818 8:22697589-22697611 GACTAGATATCTTTAGCAAACGG - Intergenic
1039063819 8:33592647-33592669 GAATGCAGATCTCTGGCAAAAGG + Intronic
1039672092 8:39612827-39612849 CATTGGAGAGATTTAGCAAATGG + Intronic
1042798708 8:72693342-72693364 CACAGGAGTGCTTTTGCAAAAGG - Intronic
1045009393 8:97944331-97944353 GACTGGAGAGCTGGGTCAGACGG - Intronic
1045594401 8:103635897-103635919 GGCTGGAGAGCTTGGGCAGGGGG + Intronic
1046360936 8:113154719-113154741 TACTTCAGAGCTTTGGTAAAAGG + Intronic
1046964557 8:120149732-120149754 GGCTGGAGTGCAATGGCAAATGG + Intronic
1047558441 8:125959848-125959870 AACTAAAGAGCTTTTGCAAAAGG - Intergenic
1048694465 8:137009829-137009851 GAAAGGAGAGCTTCAGCAAATGG - Intergenic
1052779692 9:32768282-32768304 GACTGAAGAGTTTTGGCATAAGG - Intergenic
1052832648 9:33228661-33228683 GACAGGAGAGGTTCTGCAAAGGG + Intronic
1053122698 9:35558505-35558527 GACTGGTGAGCTCTGGGAATTGG - Exonic
1055862173 9:80764861-80764883 CACTGGAGAGCTTTGAGCAAAGG - Intergenic
1056178064 9:84055162-84055184 AACAGGAGTGCTTTTGCAAAAGG + Intergenic
1056310983 9:85340728-85340750 AACTGGAGAAATTTGGTAAATGG - Intergenic
1058151180 9:101465293-101465315 GACTGAAGGGCTTGGGCAAAGGG + Intergenic
1058946946 9:109865994-109866016 GATTGGAGTTCTTTGGTAAATGG + Intronic
1062125116 9:134856043-134856065 GAATGTGGAGCTTTGACAAACGG - Intergenic
1190455518 X:50624013-50624035 GAATGGAGAGCAATGGCTAATGG + Intronic
1193695769 X:84706143-84706165 GACTGGATTGCTTTGGTCAAAGG - Intergenic
1195109789 X:101636420-101636442 GACTGGAGAAATTTGGAGAATGG + Intergenic
1195654253 X:107319983-107320005 GAATGGGGAGATTTGGCTAAAGG + Intergenic
1195915924 X:109935447-109935469 GACTGGTGATCTCTGACAAAAGG + Intergenic