ID: 1075359055

View in Genome Browser
Species Human (GRCh38)
Location 10:121813327-121813349
Sequence GTTGAGATGGAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 539}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075359055_1075359061 -10 Left 1075359055 10:121813327-121813349 CCCTCCTCATTCTCCATCTCAAC 0: 1
1: 0
2: 3
3: 55
4: 539
Right 1075359061 10:121813340-121813362 CCATCTCAACCTTGGGTAAGAGG No data
1075359055_1075359063 5 Left 1075359055 10:121813327-121813349 CCCTCCTCATTCTCCATCTCAAC 0: 1
1: 0
2: 3
3: 55
4: 539
Right 1075359063 10:121813355-121813377 GTAAGAGGTTCATTTATTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075359055 Original CRISPR GTTGAGATGGAGAATGAGGA GGG (reversed) Intronic
900822487 1:4900034-4900056 GATGAGCTGGGGAATGGGGAAGG + Intergenic
900846282 1:5104567-5104589 GTTGAGATTCACAATGGGGATGG + Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902093538 1:13923669-13923691 GATGAGGAGGAGGATGAGGAGGG + Intergenic
902546526 1:17193867-17193889 GTGGGCATGGAGAATGTGGAGGG + Intergenic
903049090 1:20587665-20587687 GTTTGGATGGGGAATGGGGAAGG - Intergenic
903213935 1:21832947-21832969 GGTGAGATGGAGGCAGAGGAGGG + Intronic
904257089 1:29260658-29260680 GTTGAGCTGGATGATGAGGTAGG - Exonic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904734800 1:32623425-32623447 ATTGAGAGTGAGAATGAGGGAGG - Intronic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905565639 1:38962334-38962356 GTTGGGGTGGGGAATGATGATGG - Intergenic
905758648 1:40534625-40534647 GTTGCTATTGAGAATGAGGTAGG + Intronic
906680274 1:47721531-47721553 GTGGAGATGGGAAATGTGGATGG - Intergenic
906937748 1:50229202-50229224 GCTGAGATGTGGAATGAGCAGGG + Intergenic
907013924 1:50992495-50992517 GTTGAGATGAAGAATAAAGGAGG - Intergenic
907603847 1:55795677-55795699 ATTGATATGGGGAATTAGGAAGG + Intergenic
908535465 1:65072614-65072636 GGTGTGATGGAGGATGAGGCTGG - Intergenic
910667617 1:89741741-89741763 GTTGAGGTGGGGAATGGGGAAGG + Intronic
910770320 1:90824333-90824355 TTTGAGGTGGAGAAGAAGGAAGG - Intergenic
911018585 1:93363168-93363190 GTTAAGATGGGGAAAGAGGAGGG - Exonic
911391724 1:97253557-97253579 TGTGAGATGGAGGATGAGAATGG - Intronic
911714216 1:101111887-101111909 TTTCTGATGGATAATGAGGAAGG + Intergenic
913317814 1:117567314-117567336 GTTGAGGTGGGGAGTGTGGAAGG + Intergenic
913576847 1:120183767-120183789 GTAGTGATGGAGTAAGAGGATGG - Intergenic
914558756 1:148795202-148795224 GTAGTGATGGAGTAAGAGGATGG - Intergenic
914614077 1:149335028-149335050 GTAGTGATGGAGTAAGAGGATGG + Intergenic
914900555 1:151709086-151709108 GTTGAGATGGAGGAGGAGAGGGG + Intronic
915305932 1:154978389-154978411 TTTTCGATGGAGAATGAGGCAGG - Intronic
917750690 1:178050592-178050614 TTTGAGCTGGAGAATGATGAGGG + Intergenic
918107349 1:181426177-181426199 GTTGAGATGGAGTGACAGGAGGG - Intronic
918107615 1:181427389-181427411 GTTGAGATGGAGAAGGAATGAGG - Intronic
918252639 1:182717259-182717281 GTTGAGGTTGAAGATGAGGATGG - Intergenic
918481722 1:184985305-184985327 ATTGGGATGGAGAATGATGGAGG + Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920277328 1:204816228-204816250 GTTGAGGAGGAGGATAAGGAGGG + Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920693050 1:208161286-208161308 GGTGAGAAGGGGATTGAGGAAGG - Intronic
921096752 1:211893405-211893427 GCTGAGATGGGGAATGAGGGAGG + Intergenic
921177086 1:212604913-212604935 GCTGTGATGGGGAACGAGGATGG + Intronic
921188807 1:212692163-212692185 TTGGAGATGGAGAACAAGGAGGG + Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921545389 1:216468471-216468493 GTTGAAATGGAGAATGCTGTGGG + Intergenic
921637623 1:217514489-217514511 GTTGGGATAGAGAATAAGGATGG + Intronic
921993827 1:221396073-221396095 GAAGAGATGGACAAGGAGGAAGG - Intergenic
922011778 1:221596117-221596139 GTTGTGATTGAGAATGAACAAGG - Intergenic
922367687 1:224881376-224881398 GTAGAGCTGGAGAAAGAGAAGGG + Intergenic
922559141 1:226555431-226555453 GCTGAGATGGGGAAAGAGGAGGG - Intronic
922960660 1:229643128-229643150 GTTGAGGAGGAGGAAGAGGAGGG + Intronic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
924227483 1:241933779-241933801 GTTAAGATTAAGAATGAGGCTGG - Intergenic
1063618283 10:7621387-7621409 TTTGATATGGACCATGAGGAAGG + Intronic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1064577938 10:16764747-16764769 TTTCAGATGGACAATGAGGGGGG + Intronic
1065044930 10:21738659-21738681 GTTAAGATGAAGAATGAGAAGGG - Intronic
1065126850 10:22582163-22582185 GTTCTGAGGGAGAATTAGGAAGG - Intronic
1065861982 10:29879518-29879540 GCTGTGATGGTGAATCAGGAGGG - Intergenic
1067972998 10:50992523-50992545 GTTGGGATGAAGAAGGCGGAGGG + Intronic
1068522052 10:58087655-58087677 GCAGAGATGGAGGATGTGGAAGG - Intergenic
1068588471 10:58827885-58827907 GTTGAGAAGGAGGAGGAGAAGGG - Intronic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071812927 10:89203257-89203279 GAACAGCTGGAGAATGAGGATGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072559540 10:96558282-96558304 GTTGAGGTGGGGATTGAGGTAGG + Intronic
1072564607 10:96607184-96607206 GCAGAGAGGGAGAGTGAGGATGG - Intronic
1072930275 10:99656429-99656451 GTCAAGATGGAGAATATGGATGG + Intergenic
1074031333 10:109691607-109691629 GTTAAGATATAGAAAGAGGAAGG + Intergenic
1074733017 10:116397703-116397725 GTGGAGATTTATAATGAGGAAGG + Intergenic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1075144121 10:119868895-119868917 GCTGGGATGGAGTATGAGGAGGG + Intronic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075414678 10:122253567-122253589 TTTGAGATGTAGCATAAGGAGGG - Intronic
1075473306 10:122710450-122710472 ATTGAGATGGAATATGAGGCTGG + Intergenic
1075605893 10:123807659-123807681 GCTTAGATGGAAAAGGAGGAGGG + Intronic
1075936045 10:126342148-126342170 GGTGAGATGGGGAATAAGGTGGG + Intronic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1076074417 10:127522063-127522085 GGGGAGAGCGAGAATGAGGATGG - Intergenic
1077060067 11:614070-614092 GGGGAGCTGGAGAATTAGGAGGG - Intronic
1077724292 11:4658614-4658636 GTTGTGATGGAGTTTGAGTAAGG + Intergenic
1077728034 11:4696384-4696406 GATGAGAGAGAGAAAGAGGAGGG - Intronic
1077866402 11:6224880-6224902 TTTGAGATGGAGAAAGTTGAAGG - Intronic
1078196686 11:9142695-9142717 GTTGAGCTGGAGTATGAGGGTGG - Intronic
1079386667 11:19986181-19986203 CTGGAGATGGAGGATGAGGGTGG + Intronic
1080121739 11:28685736-28685758 GCTGAGGAGGAGGATGAGGAGGG + Intergenic
1081057853 11:38432276-38432298 GATGAGGAGGAGGATGAGGAGGG + Intergenic
1081434527 11:43012406-43012428 GATGAGATGAAGAATGAGAACGG + Intergenic
1081919444 11:46759350-46759372 GATGAGATTGAGAATGACAATGG - Exonic
1083313050 11:61795512-61795534 GATGTGCTGCAGAATGAGGAGGG + Exonic
1084196253 11:67524756-67524778 GGTGAGATGGAAACTGAGCAAGG - Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084906067 11:72348618-72348640 GCTGTCATGGGGAATGAGGAGGG - Intronic
1085131261 11:74040817-74040839 GTTGTCCTGGAGAATAAGGAGGG + Intronic
1085196570 11:74675961-74675983 GTAGAGATGGAGAATGATGGCGG + Intergenic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087224806 11:95586643-95586665 GTTAGTATTGAGAATGAGGAAGG - Intergenic
1087569634 11:99909038-99909060 ATTCAGCTGGAGAAAGAGGAAGG - Intronic
1088224318 11:107603010-107603032 GTTGAGTGGGAGAAGAAGGATGG + Intronic
1088297910 11:108321024-108321046 GTTGAGTAGGATAAGGAGGAAGG + Intronic
1090050194 11:123371202-123371224 GTTGAGAGGGTGACTGAGAAAGG + Intergenic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090205671 11:124882774-124882796 GTTGAGAGGCTGAATGAGGCAGG - Intergenic
1091269138 11:134293362-134293384 TTTGGGATGGGGAAGGAGGAGGG + Intronic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092216628 12:6688534-6688556 TTAGAGATGGAGGAGGAGGAGGG + Intronic
1092278769 12:7083132-7083154 GTTGAGGGGGAGAATGGAGAGGG + Intronic
1092391019 12:8079399-8079421 GTTGAGATGAAGCAAGAGAAGGG + Intergenic
1092479106 12:8844223-8844245 GTTGGGAGGGAGAGTGGGGAGGG + Intronic
1092584368 12:9881590-9881612 GAAGAGATGGAGAATGAAGATGG + Exonic
1093744227 12:22721555-22721577 GAAGAGATGGAGAAGCAGGAGGG + Intergenic
1093905772 12:24690506-24690528 GTTGAGATTGAGGTTGAGGTTGG - Intergenic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1095257402 12:40054670-40054692 GTTGAGATGGTGAATCAGCTTGG - Intronic
1095822398 12:46492675-46492697 CTTGAAATGGGGAAAGAGGAAGG + Intergenic
1096161865 12:49385668-49385690 GCTGAGAGTGAGGATGAGGAGGG + Intronic
1096533758 12:52258075-52258097 CTAGAAATGGGGAATGAGGATGG - Intronic
1096615842 12:52833180-52833202 TTTGGGGTGGACAATGAGGAGGG - Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097974215 12:65667188-65667210 GTTGAGATAGAGAATCAGTGGGG - Intergenic
1098562341 12:71888733-71888755 GCTGAGATTGAGAAAGAGTAGGG - Intronic
1099230706 12:80020718-80020740 GGAGAAATGGAGAATGAGGGTGG - Intergenic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1100405834 12:94272338-94272360 GCTGGGATGGGGAATGAGGCTGG - Intronic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1101195781 12:102380702-102380724 GTGGATGTGGAGAAAGAGGATGG + Intergenic
1101428389 12:104606325-104606347 GATGAGGAGGAGGATGAGGAGGG + Intronic
1101714845 12:107301749-107301771 GTGGAGATGGGGCATGAGGTAGG - Intergenic
1101808504 12:108087011-108087033 GATGAGACAGAGAAGGAGGAAGG - Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101945032 12:109130153-109130175 GTGGAGATGGTGAATGCTGATGG + Intronic
1101987682 12:109460561-109460583 GCAGAGAGGGAAAATGAGGAAGG + Intronic
1102356292 12:112239051-112239073 GTTGAGTGGGAAAAAGAGGAAGG - Exonic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103204738 12:119119799-119119821 GATGAGATGGAGAATGGAGGAGG + Intronic
1103206917 12:119136956-119136978 GAGGAGATGGAGAAAGAGAAGGG - Intronic
1106145799 13:27048917-27048939 TTGGAGGTGGAGAATGAGGCGGG - Intergenic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107061917 13:36168518-36168540 GTTTGGATGGTGAATGAAGAAGG + Exonic
1107148555 13:37086200-37086222 GGTGAGAAGGAGAAAGAGGAGGG + Intergenic
1107252523 13:38381054-38381076 ATCGGGATGGAGAATGAGGCTGG + Intergenic
1107797452 13:44067264-44067286 GTTAAGAGGGAGACTGAGGCCGG + Intergenic
1108881109 13:55117298-55117320 ATTGAGTTGGACATTGAGGATGG + Intergenic
1110499557 13:76210886-76210908 GTTTAAATGGAGAAACAGGAAGG - Intergenic
1110514206 13:76389848-76389870 TTAGAGATGGAAAATGAGTAAGG - Intergenic
1110619140 13:77576091-77576113 GCTGAGATGGAAAGAGAGGAAGG - Intronic
1110708109 13:78618504-78618526 GTTGAGATGGGGAATGAATTGGG - Intronic
1111426070 13:88084752-88084774 ATTGAGATGTATAATGAGGTGGG - Intergenic
1112057188 13:95700574-95700596 GTTTAGAAGGAGAAAGAGCAAGG + Intronic
1112379428 13:98874577-98874599 GGTGGGATTGAGGATGAGGATGG - Intronic
1112938240 13:104827472-104827494 GAAGAGATGGAGAAAGAGGGAGG + Intergenic
1113556475 13:111239636-111239658 GTGGAGATGGTTAATGATGAGGG + Intronic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114649760 14:24277051-24277073 GTGGGCATGGAGAGTGAGGATGG + Intergenic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1115631531 14:35250651-35250673 GTAGAGAGGTAGATTGAGGAAGG + Intronic
1116550277 14:46228797-46228819 CTTGAGATAGGAAATGAGGAAGG - Intergenic
1116556214 14:46312307-46312329 GTTGAAATGGAGAATTATGTAGG - Intergenic
1116984903 14:51208029-51208051 GTTGGGATAGAGGAAGAGGAGGG - Intergenic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119523149 14:75301272-75301294 GTGGAGATGGTAAATGAGGCTGG + Intergenic
1119659565 14:76440584-76440606 GTTGAGAGAGAGAGAGAGGAAGG - Intronic
1119891757 14:78188080-78188102 TTAGAGATGGAGAAACAGGATGG + Intergenic
1120717254 14:87853174-87853196 ATTGGGATGGAGAAAGAGTATGG - Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1120929231 14:89831641-89831663 GTTTACCTGGAGAATGAGAATGG + Intronic
1121212807 14:92221707-92221729 TCTGGGATGGAGCATGAGGAGGG - Intergenic
1121826872 14:97017363-97017385 GCTGAGCAGGAGAATGAGGTGGG - Intergenic
1122365123 14:101190504-101190526 GTTGTGATGAAGACTGAGCAAGG - Intergenic
1122685800 14:103505593-103505615 GTTGAGATGCGGAATGTGGCTGG + Intergenic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1122916095 14:104859660-104859682 GTGGAGATGGAGGATGGAGATGG - Intergenic
1122916120 14:104859762-104859784 GTGGAGATGGAGGATGGAGATGG - Intergenic
1123914916 15:25014353-25014375 GTAAAGATTGGGAATGAGGAAGG + Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125030999 15:35076026-35076048 ATTGAGATGGAGAAGATGGATGG - Intergenic
1125162774 15:36665548-36665570 GTTAGGATAGAGAAAGAGGATGG + Intronic
1125552709 15:40559087-40559109 GTTGAGAAAGAGAGAGAGGAAGG - Intronic
1125743826 15:41985863-41985885 GTTGAGGTGGATGATGAGGTCGG + Exonic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126750615 15:51873136-51873158 GATGAGATGAAGAGAGAGGAAGG - Intronic
1128555418 15:68628405-68628427 GTTGCGATGAAGACTAAGGAAGG + Intronic
1128577239 15:68784396-68784418 GATGAGGAGGAGGATGAGGATGG - Exonic
1128744640 15:70104734-70104756 GTTGGGATGGGGAATGGGGAGGG + Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1128804247 15:70518786-70518808 GTTGAGATGATGAAAGAGAATGG - Intergenic
1130616541 15:85414511-85414533 GATGATATAGAGAATGAAGATGG + Intronic
1130726660 15:86445987-86446009 CTTGAGATGGAGAGAGAGGGAGG + Intronic
1131152225 15:90054298-90054320 GATGGGATGGAGAAGGCGGAGGG + Intronic
1131639104 15:94270589-94270611 GGGGAGATGGAGAAAGAGCAAGG - Intronic
1131969909 15:97881595-97881617 GATGGGGTGGAGAGTGAGGATGG - Intergenic
1133898697 16:9953034-9953056 CTTGAGCTTGAGTATGAGGAAGG + Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134472339 16:14537337-14537359 GGTGGGATGGAAAATTAGGATGG + Intronic
1134674430 16:16079440-16079462 GCTGAGATGGACAAAGTGGAGGG + Exonic
1134692972 16:16203262-16203284 GGTGAGAAGGACACTGAGGAAGG - Intronic
1134978875 16:18591433-18591455 GGTGAGAAGGATACTGAGGAAGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1138095670 16:54209481-54209503 GGTGAGATGGAGAGAGAGGCTGG + Intergenic
1138157937 16:54722991-54723013 CTGGAGGTGGAGGATGAGGATGG + Intergenic
1139042140 16:63010752-63010774 TTTAAGTTGGACAATGAGGAGGG - Intergenic
1139322159 16:66123614-66123636 GTTGAGAGGGAGGAAGGGGAGGG + Intergenic
1139801017 16:69522840-69522862 GTTCAGAGAGTGAATGAGGAAGG - Intergenic
1141879612 16:86849110-86849132 GGAGTGATGGAGGATGAGGAAGG - Intergenic
1142337874 16:89502016-89502038 GTGGACATGGAGCAGGAGGAGGG - Intronic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1142642088 17:1290035-1290057 GATGAGATGGAGTATGGGGGAGG - Intronic
1142744653 17:1949803-1949825 GTTGAGATAGAGACAAAGGAAGG + Intronic
1143391314 17:6560892-6560914 GATGAGAAGGAGGAAGAGGAGGG - Intergenic
1143853494 17:9831274-9831296 TGTGAGACGGAGGATGAGGAAGG - Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144486668 17:15671728-15671750 GTTAAGATTGAGAATAAGGCCGG + Intronic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1145967452 17:28930084-28930106 ATTGAGCTGGAGAAAGAAGAGGG - Intronic
1147441732 17:40451718-40451740 GCTGAGCTGGAGAAAGAGGTTGG - Intronic
1147742041 17:42675300-42675322 GTTGAGGTGGAGCATGAGGGAGG + Intronic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148448718 17:47759107-47759129 GGGGAGATGGAGGAAGAGGAGGG + Intergenic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148716439 17:49719382-49719404 GTAGAGATGGAGAAGGGGCAGGG + Intronic
1149139046 17:53407872-53407894 GCTGAGATGGAGAATAAGCAGGG - Intergenic
1149572154 17:57679633-57679655 GTTGGGATGGGGAGTGAGGCTGG - Exonic
1150840788 17:68603655-68603677 GTAGAGATGGAAAAGGAGGGAGG - Intergenic
1151398963 17:73843317-73843339 GGGGAGATGGAGCATGAGAAAGG + Intergenic
1151529650 17:74696123-74696145 TGAGAGATGGAAAATGAGGAAGG + Intronic
1151908202 17:77063405-77063427 GTTGAGATGGAGTCTCAGGCCGG + Intergenic
1153702897 18:7713961-7713983 GGTGAGATGGAAAATTAGCAAGG + Intronic
1154031366 18:10756694-10756716 GGAGAAATGGAGGATGAGGAGGG + Intronic
1155242355 18:23875847-23875869 GTGGAGATGGGGGATGAGAAGGG - Intronic
1155405184 18:25480115-25480137 GGTGGGATGGAGAATGGGGCAGG + Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1155941043 18:31802388-31802410 GGTGAGGGGGAGAATGTGGAGGG - Intergenic
1156290867 18:35747812-35747834 TTTGAGGTGGAGAATGAAGCAGG + Intergenic
1157279744 18:46338528-46338550 GTTGAGGTGGGGAAGGGGGAAGG + Intronic
1157510106 18:48265005-48265027 GTGGAGATGGGGTAGGAGGAGGG + Intronic
1157864766 18:51171830-51171852 ATTAATATGGAGCATGAGGATGG - Intergenic
1159414698 18:68129286-68129308 GTTGATTTGGAGAATGAGTTGGG - Intergenic
1160367083 18:78335530-78335552 GGAGAGAGGGAGAAGGAGGAGGG + Intergenic
1160402235 18:78619516-78619538 GCTGTGATGGAGGAAGAGGAAGG - Intergenic
1160676594 19:394455-394477 GGAGAGATGGGGAAGGAGGATGG + Intergenic
1161875940 19:6909638-6909660 CTTGAGATGGATAATGGTGATGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163073833 19:14870169-14870191 GGTAAGAAGGAGAATGTGGATGG + Intergenic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1167144496 19:47673569-47673591 GTGGCGATGGATGATGAGGATGG + Exonic
1167419031 19:49392154-49392176 GGAGAGATGGAGACAGAGGAAGG + Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168657673 19:58142832-58142854 GATGAGAGGGAGAAGGAGAAAGG - Intronic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
925962297 2:9029003-9029025 GATGAGTTGGAGAATTTGGAAGG - Intergenic
926332354 2:11835999-11836021 GTTGAAAATGAGAATCAGGAGGG - Intergenic
926418354 2:12673161-12673183 GCTGAGATGGAAAATCTGGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926907603 2:17820724-17820746 TTTGTGTTGGAGAAGGAGGAGGG + Intergenic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
928026021 2:27739216-27739238 GTTAAGATGGAAAAGTAGGAAGG + Intergenic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
929570775 2:43021733-43021755 GCTGAGATGGAAAATCTGGAAGG + Intergenic
930271262 2:49260301-49260323 ACTGAGATGGAGAACAAGGAAGG + Intergenic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
931087070 2:58844294-58844316 GTTGACATGGAGAATAATTAGGG - Intergenic
931153303 2:59598984-59599006 ATTGAGATGGAGAATAACCAAGG + Intergenic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
931686200 2:64796249-64796271 GTAGAGATGGAGAAAGTGAATGG + Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
934652389 2:96099942-96099964 GGTGAGAAGGAGAAAGAGGAAGG + Intergenic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
935896434 2:107742785-107742807 GCTGAGGTGGAGACTGAGGTGGG + Intergenic
935978092 2:108599167-108599189 GGTGAGATGGGGAATGGGAAGGG - Intronic
936034838 2:109102689-109102711 GGGGAGAGGGAGGATGAGGAAGG + Intergenic
936076490 2:109404845-109404867 GTCAAGATGGCGGATGAGGAAGG - Intronic
936111050 2:109665203-109665225 TTTGAGATGCAGAATGATGCTGG + Intergenic
936115507 2:109699646-109699668 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
936135712 2:109891763-109891785 GGTGAGATGGGGAATGGGAAAGG - Intergenic
936182070 2:110275632-110275654 GTTCAGATAAAGAATGAGGGTGG + Intergenic
936208985 2:110479722-110479744 GGTGAGATGGGGAATGGGAAAGG + Intergenic
936230499 2:110696041-110696063 GTTCAGATAAAGAATGAGGGTGG - Intergenic
936285454 2:111177926-111177948 GGTGAGATGAGGAAGGAGGAGGG - Intergenic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
940383482 2:153043572-153043594 GTTGGCATGGAGAGAGAGGATGG + Intergenic
940692925 2:156941834-156941856 GATGAGAAGGAGTTTGAGGAGGG + Intergenic
940956020 2:159728444-159728466 GTTGAGATGGGGAAATAGAAAGG + Intronic
942069198 2:172300112-172300134 GTTCAGATGGAGAGGGAGGGAGG + Intergenic
942168377 2:173264861-173264883 GGGGAAATGGAGAAAGAGGAAGG + Intronic
942569743 2:177301990-177302012 TCTGAGATGGAGACTGAGTAGGG - Intronic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944943929 2:204661193-204661215 TTTGAGATGGGGAAAGAGGAAGG - Intronic
945123537 2:206484255-206484277 GTTGGGATGGAGAGGGAGGTTGG + Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946144442 2:217718451-217718473 GTTGGGCTGGAGAAGGAGAAAGG - Intronic
946182695 2:217958477-217958499 GCTGGGATGGAGAATGACGATGG + Intronic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
947310203 2:228793457-228793479 GTAGATGTGGAGACTGAGGAAGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948220181 2:236263057-236263079 GTTGGGAGGGAGAATGGGGGTGG + Intronic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948447136 2:238041418-238041440 ACTGAGAGGGAGCATGAGGACGG - Exonic
949071177 2:242025201-242025223 GTGGAGCTGGAGACTGAGGGAGG + Intergenic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169113991 20:3050932-3050954 GTTGAAATGGACAACTAGGAAGG + Intergenic
1169152161 20:3297911-3297933 GATGAGAGGGAGAGTTAGGAGGG - Intronic
1169194467 20:3675726-3675748 GTTGAGATGGAGCCTGAAGATGG - Intronic
1170058151 20:12229830-12229852 TCTGAGATTGAGGATGAGGAGGG - Intergenic
1170227441 20:14007397-14007419 GTTGAGAGGGAGGAAGAGGGAGG - Intronic
1172356155 20:34281412-34281434 CTTGAGTTGAAGAATGAGGAAGG - Intronic
1172584404 20:36072397-36072419 AATGAAATGGAGAATAAGGAAGG + Intergenic
1172677483 20:36684211-36684233 GTTGTGATAGAGAATAAGGGTGG - Intronic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173626576 20:44477155-44477177 GGTGCGATGGAAAATGAGGCTGG + Intronic
1173913271 20:46686876-46686898 GTTGGGATGGGTACTGAGGAAGG + Exonic
1174060972 20:47832912-47832934 GTTGAGCTGGAGATTCAGGGAGG - Intergenic
1174061247 20:47834466-47834488 GTTGAGCTGGAGATTCAGGGAGG - Intergenic
1174070529 20:47896233-47896255 GTTGAGCTGGAGATTCAGGGAGG + Intergenic
1174070925 20:47898458-47898480 GTTGAGCTGGAGATTCAGGGAGG + Intergenic
1174100177 20:48121324-48121346 GTTGAGCTGGAGATTCAGGGAGG - Intergenic
1174153473 20:48502099-48502121 GTTGAGCTGGAGATTCAGGGAGG - Intergenic
1174159471 20:48540764-48540786 GTTGAGCAGGAGAAAGAGAAGGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176003480 20:62845772-62845794 GAAGAGCTGGAGAATGGGGAAGG + Intronic
1176905618 21:14497030-14497052 GCCCAGATGGAGAGTGAGGAGGG - Intronic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1181886029 22:26023107-26023129 GTGGTGATGGAGAAGAAGGAAGG - Intronic
1182404663 22:30115784-30115806 GCTGAAGTGGAGAATGAAGAAGG + Intronic
1182541391 22:31044594-31044616 GTGGAGCTGGTGAATGTGGAGGG + Intergenic
1183929875 22:41229870-41229892 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1184377403 22:44123372-44123394 TTTGAGAGGGAGAGAGAGGAAGG + Intronic
1184920417 22:47601618-47601640 GGAGGGATGGAGAAGGAGGAGGG - Intergenic
949807695 3:7973791-7973813 GTAGAGGTGGAAAATAAGGAAGG + Intergenic
950136663 3:10585797-10585819 GATGTGATGGAAAATGACGAGGG - Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951691651 3:25402821-25402843 GTTGGGGTGGGGCATGAGGATGG + Intronic
952419049 3:33114700-33114722 GTTGAGATGAAGAAGGAGACAGG - Intronic
952505065 3:33999760-33999782 GCTGAGAGGGATAATGAGGTGGG - Intergenic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
954419892 3:50413182-50413204 GTGGTGGTGGAGCATGAGGAGGG + Intronic
954770652 3:52965149-52965171 TTTGAGCTGGAGAAGGAAGAGGG - Intronic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
954977062 3:54706225-54706247 GCTGAGATGGAGTTTGGGGATGG + Intronic
955132802 3:56187755-56187777 GCTGAGATAGAGAATGATGGGGG + Intronic
955408317 3:58639781-58639803 GTTGGGATGGAGATGGAGGAGGG + Intronic
957507413 3:81140816-81140838 GAAGGGAGGGAGAATGAGGAAGG + Intergenic
959013376 3:101105114-101105136 GTTGAGATTGAAAATGTGAATGG - Intergenic
959138699 3:102457238-102457260 TTTGACATGGAAAATGAGAAAGG + Intronic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959561619 3:107788996-107789018 GTTGAGCTGGACAAGGAGGGTGG + Intronic
959661648 3:108875184-108875206 CTTGACATGGAGAAAGAGAAAGG + Intergenic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961168304 3:124778798-124778820 GTAGAGATGGAGTGGGAGGAAGG + Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961779531 3:129313616-129313638 GTGGAGATGGTGAATGATGAGGG - Intergenic
961951011 3:130749080-130749102 ATTGAGATGGAGAAGAAGGGAGG - Intergenic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962675975 3:137759017-137759039 GTTGAGATAATGAATGAGTAAGG + Intergenic
962875044 3:139529542-139529564 GGTGGGATGGGGAATCAGGATGG + Intronic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
963853032 3:150226575-150226597 GGTGAGTTGTTGAATGAGGAAGG + Intergenic
965179445 3:165383245-165383267 GATGAGATGGAAAAGGAGAAAGG + Intergenic
965412443 3:168348792-168348814 GTTGGAATGGAAAGTGAGGAAGG + Intergenic
965465812 3:169029441-169029463 GTTGATTAGGAGAATGAAGAAGG - Intergenic
965930730 3:174039747-174039769 GTTGAGATGGACAATGTGTTTGG + Intronic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
967298717 3:187991065-187991087 GTGGCGATGGAGAAGGAGAAAGG - Intergenic
967312953 3:188123378-188123400 GTTGTTTTAGAGAATGAGGAAGG - Intergenic
967318319 3:188171424-188171446 ATCCAGATGGAGAATGAGAAAGG - Intronic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
967648605 3:191957467-191957489 GGAGGGATGGAGAAGGAGGAAGG + Intergenic
967848608 3:194064681-194064703 GAAGAGATGGAGAAAGAGGAAGG + Intergenic
969108854 4:4828818-4828840 GGAGAGAAAGAGAATGAGGAGGG - Intergenic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
971174024 4:24263589-24263611 GTGGAGATGGACAAGGTGGAAGG - Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972234854 4:37120061-37120083 GTGAAAATGGAGAGTGAGGATGG - Intergenic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
972569066 4:40294447-40294469 GTGGAGATGGAGATGGAGGTGGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
975231484 4:71939399-71939421 GGGGAGATAGAGAAAGAGGAAGG - Intergenic
977286357 4:95112221-95112243 GATGAGATGAAGAATCATGAAGG - Intronic
978468815 4:109038947-109038969 ACTGAGATGGAGAATAAAGATGG - Intronic
979557124 4:122061856-122061878 GCTGAGAAGGAGAAAGAAGAGGG - Intergenic
979874615 4:125872273-125872295 TTAGAGATTGAGAATGAGGGAGG - Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
980623839 4:135345357-135345379 GTTGTGATGGTGAATGGGGCAGG - Intergenic
981421913 4:144560628-144560650 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
981532495 4:145765681-145765703 GCTGAGAGGGAGGATGAAGAGGG + Exonic
981551863 4:145949850-145949872 GTTGAGCAGGACAGTGAGGAGGG + Intergenic
981618724 4:146669987-146670009 GTTGAGGTTGGGAATGAAGAGGG + Intergenic
982217244 4:153093017-153093039 GTGGAGAGGGAGAATGGAGATGG - Intergenic
982797393 4:159662883-159662905 GGAGAGAGGGAGAATGAGGTGGG + Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
985362578 4:189191537-189191559 GTTCACATGAGGAATGAGGATGG + Intergenic
985884313 5:2664796-2664818 TTTGAGATAGAGAGGGAGGAAGG + Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
989166267 5:38436339-38436361 CCTGAGATGGAGCATGAGGGAGG + Intronic
990429863 5:55724143-55724165 ATTGAGATTGAGAATAAAGAGGG + Intronic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
990867362 5:60395075-60395097 ATTAAGATGGAGCATGAGGAAGG - Intronic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
994148432 5:96420718-96420740 GTTCTGAGGGAGAATAAGGAAGG + Intronic
994526122 5:100906667-100906689 GTTGATAGGGAGACTGAGTATGG - Intergenic
996588651 5:125120379-125120401 GCTGAGATGGAAGATGGGGAAGG + Intergenic
997262392 5:132475073-132475095 GTGGAGATGGAGGAGGGGGAAGG + Intronic
998181404 5:139947993-139948015 CTGGAGATGGAGAATGGTGATGG - Intronic
998478066 5:142438062-142438084 GTTGAGATGGAGAGTGACTGGGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999429588 5:151514691-151514713 GCTGAGAGTGGGAATGAGGAGGG - Intronic
1000101780 5:158023612-158023634 GCTGAGATGAAGAATGAGCAGGG + Intergenic
1000259410 5:159572251-159572273 GTGAAGCTGGAGAATGGGGATGG + Intergenic
1001526863 5:172435355-172435377 GGTAAGATTGAGAATGAGGATGG + Intronic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1001916835 5:175568967-175568989 CTTGGGATGGGGATTGAGGAAGG + Intergenic
1002352339 5:178591862-178591884 CTTGACCTGGAGGATGAGGAGGG - Intergenic
1002380578 5:178825351-178825373 GATGAGATGGAGGATGAAGAAGG - Intergenic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1002893471 6:1357748-1357770 GTTGAAAAGGAGGAAGAGGAGGG - Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004933063 6:20480327-20480349 GCTGAGCTGGAGATTGAGGTCGG - Intronic
1005007258 6:21300126-21300148 GTTGAGGTAGAGAATGTGTAGGG + Intergenic
1005429090 6:25735299-25735321 AATGAAATGGAGAATGAGCAAGG + Intergenic
1005648294 6:27863459-27863481 ATTAAAATGGAGAAAGAGGAAGG - Intronic
1005768946 6:29045271-29045293 GTAGAGGAGGAGAAGGAGGAGGG + Intergenic
1005914216 6:30338441-30338463 GAGGAGATGGAGAAAGATGAGGG + Intronic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1007362437 6:41368628-41368650 GCTCAAATGGAGAATGAGAAAGG + Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1009835385 6:68994117-68994139 ATTGAGGTGGAGAATGACTAAGG - Intronic
1011211933 6:84964740-84964762 GTTCTGATGGAGAAGGAGAAGGG + Intergenic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1012213916 6:96558158-96558180 GTTGGGAGGGAGTAAGAGGATGG + Intergenic
1012901925 6:105016637-105016659 GCAGAGAGGGAGAATCAGGATGG - Intronic
1013670802 6:112400230-112400252 GTGGAATTAGAGAATGAGGAAGG - Intergenic
1013701333 6:112773799-112773821 GTAGAGATGGAGAAGTATGAGGG + Intergenic
1014486704 6:122008115-122008137 GTTTGGATGGAAATTGAGGAAGG + Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015101794 6:129490367-129490389 GTGGTGATGGAGAATGAGTGTGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1016556960 6:145349688-145349710 GTTGAGGTGGAGGTGGAGGAGGG - Intergenic
1017303793 6:152892868-152892890 GTTGAGCTGGAGTAAGAGAATGG - Intergenic
1018472454 6:164108856-164108878 GTTGAGAGGGAGGGTGAGGTGGG - Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019356369 7:582045-582067 GTTTACATGGTGAATGGGGATGG - Intronic
1021122714 7:16815205-16815227 GGTGAGAGGGAGATTGAAGAAGG + Intronic
1021159544 7:17255158-17255180 GGAGGGATGGAGAATGAAGACGG + Intergenic
1021188940 7:17598064-17598086 GATGAGATAGTGGATGAGGAAGG - Intergenic
1021623878 7:22573739-22573761 GTTGGGAGGGAAAATGAAGAGGG + Intronic
1021737948 7:23657457-23657479 GTTTAGAAGGAGAAGGAGTAGGG - Intergenic
1021956361 7:25828834-25828856 GGGGAGATGGAAAATGGGGATGG + Intergenic
1022224061 7:28345468-28345490 GTTGTGATGGGGGATGGGGATGG + Intronic
1022270668 7:28804548-28804570 GTTAAGAAGGAGAATAAGAAGGG - Intronic
1022296817 7:29063261-29063283 GTTGAAATGATGAATGAGAAAGG - Intronic
1023098236 7:36685380-36685402 GATGGGATGGAGCATGTGGATGG + Intronic
1023660270 7:42463852-42463874 GTTGAGATATAGAAAGAAGATGG + Intergenic
1023714459 7:43029170-43029192 GCTGAGGTGGAGAATGAGGTGGG + Intergenic
1023849456 7:44141959-44141981 GTTGAGATGAGGCTTGAGGAAGG - Intergenic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024147688 7:46534044-46534066 GGTGAGATGGAGAAAGAAGTGGG + Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1025233961 7:57221104-57221126 GTTGAGCTGGAGATTCAGGGAGG + Intergenic
1026193346 7:68149738-68149760 AGAGAGATGGAGAATGAGGGTGG + Intergenic
1026923459 7:74173228-74173250 TTTGAGATGGAGAATCAGGTTGG - Intergenic
1027050540 7:75018794-75018816 GGTGAGATGGAGAATCAGGACGG + Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027488293 7:78789022-78789044 GTTGAGAAGAAGAATGTGCAGGG - Intronic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028968143 7:96826156-96826178 AGTGAGATGGGGAATGAAGAGGG + Intergenic
1029382507 7:100222876-100222898 AGTGAGATGGAGAATCAGGACGG - Intronic
1029869942 7:103680198-103680220 GGTGAGAAGGAGAGGGAGGAGGG + Intronic
1029967604 7:104756059-104756081 GTTGGGATGGGGAGTGGGGATGG + Intronic
1029976155 7:104836169-104836191 GATGGGAAGGAGAATCAGGAAGG + Intronic
1030051952 7:105545985-105546007 GTAGAGATGGGGGATGGGGAAGG + Intronic
1030161804 7:106516880-106516902 GTCTGGTTGGAGAATGAGGAAGG - Intergenic
1030272912 7:107688988-107689010 GATGAGATGGGGAAAAAGGATGG + Intronic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031611028 7:123827438-123827460 GTTGGGAAGGAAAAAGAGGAAGG - Intergenic
1032369949 7:131338897-131338919 GCTGAGAAGGAGAAAGAGAAGGG - Intronic
1033026700 7:137781477-137781499 GTTGAGAGAGAGGAGGAGGAAGG - Intronic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1033755535 7:144396161-144396183 GTTGAGATGTAGGAAGAGGAGGG - Intergenic
1033807488 7:144971378-144971400 GTGGTGATGGAGGAGGAGGATGG + Intergenic
1034062739 7:148108067-148108089 GGGGAGATGGGGAATTAGGAAGG - Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035692899 8:1571647-1571669 GATGAGATGGAGAGAGAGAAGGG + Intronic
1036213646 8:6862522-6862544 AGCAAGATGGAGAATGAGGAAGG + Intergenic
1037048558 8:14340866-14340888 CTTAAGATGGAGAGTGATGATGG - Intronic
1037454708 8:19051993-19052015 AAAGTGATGGAGAATGAGGAAGG + Intronic
1037468285 8:19182332-19182354 GGAGAAATTGAGAATGAGGAAGG - Intergenic
1037675306 8:21045840-21045862 GCTCAGATTGAGGATGAGGAGGG + Intergenic
1037789945 8:21929550-21929572 GATGAGATGGAGAATATGAAGGG + Intronic
1037912807 8:22754044-22754066 GTTCAGATGGAGGGAGAGGAGGG + Intronic
1038238385 8:25784452-25784474 GTGGTGATGGAGGAGGAGGAAGG - Intergenic
1038401469 8:27287722-27287744 GTGGAGCTGGAGTGTGAGGAGGG - Exonic
1038709026 8:29923464-29923486 GTTGGGATGGGGAGTGAAGAGGG - Intergenic
1039206589 8:35162359-35162381 GCAGAGATGGAGAAAGAGCAGGG - Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1041211302 8:55554035-55554057 GTTGAGATGGAGTATTGTGAGGG - Intergenic
1041733615 8:61087468-61087490 TCTGAGTTGGAGCATGAGGAGGG - Intronic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1044670673 8:94677325-94677347 GTTGAGATGCTGAATGAATATGG - Intronic
1045905455 8:107339545-107339567 GATGTGATGGAGGGTGAGGAAGG - Intronic
1046832893 8:118765748-118765770 ATTGAGTTGGAGAAAGAAGAGGG + Intergenic
1049695249 8:143980946-143980968 ATTGAGATGGAAGATGAGGGAGG + Intronic
1051919094 9:22243219-22243241 GATGGGAAGGATAATGAGGAAGG + Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053117097 9:35514591-35514613 GTAGGGATGGAGAATGTGGTAGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1054864711 9:69988137-69988159 GTTGAGATGGAGGATCCAGAGGG + Intergenic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1058108450 9:101002770-101002792 GCAGAGATGGAGAATTAGGCTGG + Intergenic
1058465766 9:105225579-105225601 GTTGAGATGGGAAGGGAGGAGGG + Intergenic
1058940770 9:109810802-109810824 CTTGAGTTGGGAAATGAGGAAGG + Intronic
1058969470 9:110067052-110067074 GGGAAGATAGAGAATGAGGAAGG + Intronic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059350461 9:113660643-113660665 GATGAGATGGAAAAGGAGGTAGG + Intergenic
1059647132 9:116278944-116278966 ATTGAGATAGGCAATGAGGAAGG - Intronic
1060477713 9:123998736-123998758 GGTGTGATGGGGAATGGGGAGGG + Intergenic
1060804355 9:126565119-126565141 GTTGATATTAAGAATGATGATGG + Intergenic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1062416746 9:136455029-136455051 GGTGAGATGGAGAGTCTGGAGGG + Intronic
1185477416 X:423745-423767 GTTGAGATGGGGAATAACAAGGG - Intergenic
1186049700 X:5577761-5577783 GCTGAGATGGAAGAAGAGGAGGG - Intergenic
1186224160 X:7379326-7379348 ATTGAGGTGGAGAGTGGGGAGGG + Intergenic
1186428946 X:9488035-9488057 GTTGGGTTGGAGAATATGGAGGG + Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1188144613 X:26595645-26595667 GTTAGGAGGGAGGATGAGGAGGG + Intergenic
1188417723 X:29956414-29956436 GTAGAGGTGGGGAATGAGGTGGG - Exonic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190421640 X:50290689-50290711 ATTCAGCTGGAGAATCAGGAGGG - Intronic
1190936261 X:55001292-55001314 GTGGAGGTGGAGAATTAGGTGGG - Intronic
1191592065 X:62897282-62897304 GTGGAGATGGGGAATGATGAGGG + Intergenic
1191608231 X:63084223-63084245 TTTGAGTGGGAGAATGAAGAAGG + Intergenic
1192156187 X:68748329-68748351 GTAGAGATGGGGAATGAGATAGG + Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1193219347 X:78904176-78904198 CTTGAGATGGAGATTGATGATGG - Intergenic
1193471768 X:81913205-81913227 GTGGAGATGAAGAATGAGTTAGG - Intergenic
1195093978 X:101488722-101488744 GTTAAGATGGAGACTGTGGTTGG + Exonic
1195664336 X:107415207-107415229 GAGGAGGTGGAGGATGAGGAGGG + Intergenic
1196025048 X:111033315-111033337 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196227825 X:113187792-113187814 GTTGAAATGAAGAATGATAAAGG + Intergenic
1197551033 X:127893004-127893026 TTTGAGATGGAGCAAGAGCAAGG - Intergenic
1197917397 X:131551214-131551236 GATGAGGTGGATAATGAGGATGG - Intergenic
1198073321 X:133170708-133170730 GTTAAGATGGAAAATGAGGTGGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199996669 X:153030481-153030503 GAGGAGTTGGAAAATGAGGATGG + Intergenic
1200212936 X:154354925-154354947 GACGTGGTGGAGAATGAGGACGG - Exonic
1200304397 X:155009283-155009305 GATGAGTTGGTGAATGTGGAAGG - Intronic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic