ID: 1075363913

View in Genome Browser
Species Human (GRCh38)
Location 10:121865611-121865633
Sequence CTGATATGTACTCCCCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075363913_1075363915 4 Left 1075363913 10:121865611-121865633 CCTAGCAGGGGAGTACATATCAG No data
Right 1075363915 10:121865638-121865660 TACAGAGCCACCCGAAATTAGGG No data
1075363913_1075363917 13 Left 1075363913 10:121865611-121865633 CCTAGCAGGGGAGTACATATCAG No data
Right 1075363917 10:121865647-121865669 ACCCGAAATTAGGGATCTAATGG No data
1075363913_1075363914 3 Left 1075363913 10:121865611-121865633 CCTAGCAGGGGAGTACATATCAG No data
Right 1075363914 10:121865637-121865659 CTACAGAGCCACCCGAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075363913 Original CRISPR CTGATATGTACTCCCCTGCT AGG (reversed) Intronic