ID: 1075367326

View in Genome Browser
Species Human (GRCh38)
Location 10:121903735-121903757
Sequence CTCCAAATACTGCAGGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075367324_1075367326 7 Left 1075367324 10:121903705-121903727 CCTTGCTTAGTTGAAGGTATCTG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1075367326 10:121903735-121903757 CTCCAAATACTGCAGGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075367326 Original CRISPR CTCCAAATACTGCAGGTATT TGG Intronic
No off target data available for this crispr