ID: 1075370763

View in Genome Browser
Species Human (GRCh38)
Location 10:121932939-121932961
Sequence TTGTATGAGCAGAGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075370759_1075370763 -5 Left 1075370759 10:121932921-121932943 CCAGGAAGCAGGTTTGGGTTGTA No data
Right 1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075370763 Original CRISPR TTGTATGAGCAGAGGCAGGG AGG Intergenic
No off target data available for this crispr