ID: 1075372965

View in Genome Browser
Species Human (GRCh38)
Location 10:121953471-121953493
Sequence ATTTCTGTGCTGAGGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075372965_1075372970 -1 Left 1075372965 10:121953471-121953493 CCTACCACCCTCAGCACAGAAAT No data
Right 1075372970 10:121953493-121953515 TAAGGCTCCTCCCCAGCCGTTGG No data
1075372965_1075372975 11 Left 1075372965 10:121953471-121953493 CCTACCACCCTCAGCACAGAAAT No data
Right 1075372975 10:121953505-121953527 CCAGCCGTTGGAGACATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075372965 Original CRISPR ATTTCTGTGCTGAGGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr