ID: 1075374541

View in Genome Browser
Species Human (GRCh38)
Location 10:121967874-121967896
Sequence CTCTTAAAGGTTGAGTGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075374541_1075374546 17 Left 1075374541 10:121967874-121967896 CCGCATCACTCAACCTTTAAGAG 0: 1
1: 0
2: 1
3: 10
4: 156
Right 1075374546 10:121967914-121967936 CTTTCAGTGTCTTAACATGCTGG 0: 1
1: 0
2: 1
3: 18
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075374541 Original CRISPR CTCTTAAAGGTTGAGTGATG CGG (reversed) Intronic
900838601 1:5027901-5027923 CTCTTTAAGGATGAGAGAAGAGG + Intergenic
902103829 1:14016513-14016535 CTCTCAAAGGATCAGTGTTGGGG + Intergenic
902826545 1:18978590-18978612 CTCTGAAAGCAGGAGTGATGTGG - Intergenic
904094825 1:27968439-27968461 CTCTGAGAGGTTAAGTGATGAGG + Intergenic
907082640 1:51638253-51638275 AACTTGAAGGATGAGTGATGGGG + Intronic
908028628 1:59976290-59976312 CTCTTAAAGGTTCAAGAATGTGG - Intergenic
912678130 1:111705170-111705192 CTATTTAAGGTTGACTGGTGGGG - Intronic
912908276 1:113730461-113730483 CTCTGAAATGTTGACTGATTGGG + Intronic
915165266 1:153944913-153944935 CTCTTAAAGCTTGGGTTTTGTGG - Intronic
916103532 1:161413070-161413092 CCCTTAAAGGGTCTGTGATGAGG + Intergenic
917147615 1:171909547-171909569 CTCTTATAGATTAAATGATGTGG + Intronic
919539641 1:198830929-198830951 CTCTTGCAGGGTGTGTGATGAGG + Intergenic
920802401 1:209201784-209201806 CTCCTAGAGGTTGAGGGATGGGG + Intergenic
920817362 1:209347141-209347163 CACTTGACTGTTGAGTGATGGGG - Intergenic
922459915 1:225808104-225808126 CTCTTAAAGGGTGAGTTTTATGG - Intergenic
923249154 1:232163306-232163328 CTTTTTAAGGCTGAATGATGTGG - Intergenic
923472214 1:234302033-234302055 CTGTTGAAGGATGAGGGATGAGG + Intronic
1063684210 10:8220979-8221001 CTCATAATGGTTGGGTGTTGTGG + Intergenic
1069599696 10:69695627-69695649 CTCGTAAATGTTGATTGGTGAGG + Intergenic
1071025132 10:81103880-81103902 TTCTAGAATGTTGAGTGATGCGG + Intergenic
1071491332 10:86138665-86138687 CCCTTACAGGCTGAGTGCTGTGG + Intronic
1073602962 10:104864678-104864700 CTATTAAAGCTTGAGTGTTAAGG + Intronic
1075374541 10:121967874-121967896 CTCTTAAAGGTTGAGTGATGCGG - Intronic
1075800261 10:125149355-125149377 CTCTTCCAGGTGGAGTGAAGTGG + Intronic
1076759905 10:132598571-132598593 CTTTTTAAGGCTGAGTTATGTGG + Intronic
1078585804 11:12587613-12587635 CTCTTAGAGCTAGAGAGATGCGG - Intergenic
1078623794 11:12934920-12934942 CTCTGAAATGCAGAGTGATGAGG + Intronic
1078655866 11:13238549-13238571 CACTGGAAGGTTGAGAGATGGGG + Intergenic
1079461931 11:20689005-20689027 CTCTCTAATGATGAGTGATGTGG + Intronic
1084100043 11:66941791-66941813 CTTTTTAAGGCTGAATGATGGGG - Intronic
1085373616 11:76037290-76037312 CTGTTAATGGGTGAGTTATGTGG - Intronic
1087121704 11:94581840-94581862 CTCTTACAGCTGGTGTGATGTGG - Intronic
1089639033 11:119834900-119834922 TTCTTAAATGTTGTGTGGTGGGG + Intergenic
1090026683 11:123173614-123173636 CTCTTAGAGGTTAAGAAATGTGG - Intronic
1092707902 12:11304480-11304502 CTCTTTATGATTGAGTGATATGG - Intergenic
1092890362 12:12964175-12964197 CTCTGACAGGTTGGGTGAGGAGG + Intergenic
1094451279 12:30585397-30585419 CTCTTACAGGTTGGGGGGTGAGG - Intergenic
1095641848 12:44494833-44494855 CTCTCACAGGGTGCGTGATGGGG + Intergenic
1098396794 12:70028203-70028225 CCCTTACAGGGTGAGCGATGTGG + Intergenic
1099595414 12:84656806-84656828 CCTTTTAAGGTTGAGAGATGAGG - Intergenic
1100012515 12:89970632-89970654 CTCTTAAAGGTTAATTAATCAGG + Intergenic
1101590725 12:106122865-106122887 CTCTTAAATTTTCAGGGATGTGG - Intronic
1103689119 12:122756407-122756429 CTCTCAAAGGCTGAGTGCAGTGG - Intronic
1117698869 14:58394096-58394118 CTCTTAAATTTTGAGGGCTGAGG + Intergenic
1119774100 14:77237862-77237884 CTTTCAAAGGTTCAGTGGTGTGG + Intronic
1119877517 14:78073440-78073462 CTCTCACAGGGTGAATGATGTGG - Intergenic
1124923139 15:34046032-34046054 CTGTTAAAGTTTGAGTAATCAGG + Intronic
1124963032 15:34412310-34412332 CTCTTCAAGGCTGAGTGCGGTGG - Intronic
1124979655 15:34558536-34558558 CTCTTCAAGGCTGAGTGCGGTGG - Intronic
1125128146 15:36249067-36249089 GTCTTGAAGGCTGAGTGATTGGG - Intergenic
1125249341 15:37681654-37681676 TTCTTAAAGGCTGAGTTTTGTGG - Intergenic
1126381660 15:48054373-48054395 CTCTTAACTGTTGAGTTTTGAGG - Intergenic
1127065341 15:55231581-55231603 TTCTAAAAGCTTGAGTGAGGGGG - Intronic
1127286954 15:57540947-57540969 CTCCTAATGGTTGAGAGACGGGG + Intronic
1132172062 15:99668880-99668902 CTCTTCATGGTTTAGTGATAAGG + Intronic
1133571636 16:7046322-7046344 TTCTTAAAGGTTGTGTTATAGGG + Intronic
1134378519 16:13702208-13702230 CTCTTAAGGGTTTAGTTATGAGG + Intergenic
1137830335 16:51538045-51538067 CTCTTAAAGGGGGCATGATGTGG + Intergenic
1138222865 16:55267740-55267762 CACTTAGAGGCTGAGTGATCTGG - Intergenic
1140260793 16:73377655-73377677 CACTTAAATGTTAAGGGATGGGG - Intergenic
1143040071 17:4027925-4027947 CTCTGAGAGGCTGAGTGAGGTGG - Intronic
1143744328 17:8979832-8979854 TTTTCAAAGGTTGAGTGATGAGG + Intergenic
1144861173 17:18303376-18303398 CTCGTAAAGGGTCAGTGCTGAGG + Intronic
1146386124 17:32375280-32375302 CTCTTAAATGTTGATTACTGAGG - Exonic
1149543653 17:57487460-57487482 CACTTGATGGATGAGTGATGAGG - Intronic
1151550225 17:74818433-74818455 CACTGTAAGGATGAGTGATGCGG - Intronic
1155414351 18:25581418-25581440 CTCTTCAAGGTTGGGTGTAGTGG + Intergenic
1158780583 18:60644902-60644924 CTCTAAGAGGTTGAGTGGTTTGG - Intergenic
1159500622 18:69264572-69264594 ATCATAAAGGGTGAGTGGTGTGG - Intergenic
1160071600 18:75633819-75633841 CTTTTAAAGGTTAAGAAATGAGG - Intergenic
1161640356 19:5418873-5418895 CTCTCCAAGGTAGAGTGCTGAGG + Intergenic
1165522936 19:36328804-36328826 ATCTTAAAGCTACAGTGATGTGG - Intergenic
928628254 2:33163264-33163286 CTCTTAAAGGCTGGGTGTGGTGG - Intronic
930845820 2:55902621-55902643 CTTTTAAAGCTTCAGTGATTTGG + Intronic
933323328 2:80804983-80805005 TTCTTCAAGATTGAGTGTTGTGG + Intergenic
936791431 2:116157760-116157782 TTCTTAAGGGTTGGTTGATGAGG + Intergenic
937767074 2:125673972-125673994 CTAGTAAAGGTTGAATCATGAGG + Intergenic
939198091 2:138998397-138998419 CTCTTTAAGGTTTAATTATGAGG - Intergenic
939996445 2:148925122-148925144 CTCTGAAAGGTTGGGTCCTGAGG + Intronic
940032415 2:149278017-149278039 CTCTTAAAAGTTGTATGAGGTGG - Intergenic
941574185 2:167210195-167210217 TCCTTAAAGGTTGAGGGGTGAGG + Intronic
941819380 2:169828600-169828622 CTCTTGAGGGTTGAGGGAGGAGG + Intronic
942858549 2:180582234-180582256 CTGTTAAAGATGGAGTTATGTGG + Intergenic
945961065 2:216135522-216135544 CACTTAAAAGGTGAGGGATGAGG + Intronic
947830099 2:233133690-233133712 CTCTTAAGCCTTGCGTGATGTGG - Intronic
948319672 2:237059425-237059447 TTTTTAAATGTTGAATGATGTGG + Intergenic
1168734254 20:116254-116276 CTGTATCAGGTTGAGTGATGAGG + Intergenic
1169934754 20:10871409-10871431 CTCTGAGAGGTTGAATGATGTGG + Intergenic
1170587963 20:17749834-17749856 GTCTTAAAGGGTGAGTGAGCTGG - Intergenic
1172178617 20:32987339-32987361 ATCTTAAGGGCTGAGTGGTGGGG + Intronic
1173422366 20:42913653-42913675 CTTTTCAAGATTGAATGATGAGG + Intronic
1173481925 20:43408206-43408228 CTCTTAAATTTTGTGTGAAGTGG + Intergenic
1176970285 21:15257085-15257107 CCACTGAAGGTTGAGTGATGTGG + Intergenic
1179977825 21:44880157-44880179 CTCTGAAAGGTTGGTTTATGTGG - Intergenic
1181022987 22:20113220-20113242 CTCTTCAGAGTTGAGTAATGTGG - Exonic
949442319 3:4095465-4095487 CTCTTAAATCTTGTGTGGTGTGG - Intronic
950309883 3:11948045-11948067 CTCTCAAAGGTTGAGTGTTTGGG + Intergenic
950868933 3:16212521-16212543 TTCTTAAAGGTGGAATGCTGAGG + Intronic
953093079 3:39748982-39749004 CTATTACAGGCTGAGTCATGAGG - Intergenic
953148097 3:40297722-40297744 CTCTTCCAGGTTTTGTGATGAGG - Intergenic
954803059 3:53198558-53198580 CTCTGAGAGGTTGAGTGATGTGG + Intergenic
957129332 3:76203197-76203219 CTCAGAAAGGTTGACTGATACGG + Intronic
957862737 3:85977217-85977239 CTCTTAATAATTCAGTGATGGGG + Intronic
958074397 3:88657577-88657599 CCCTTACAGGGTGGGTGATGGGG + Intergenic
964084825 3:152803702-152803724 ATCATTAAGGTGGAGTGATGGGG + Intergenic
964810517 3:160658894-160658916 CTCTTAGAGGTTGACTTATTGGG + Intergenic
965005877 3:163022396-163022418 CTCTTATAGATTCAGTGATAAGG + Intergenic
965779238 3:172266672-172266694 GTCTTGAAGCTGGAGTGATGTGG - Intronic
966987400 3:185194181-185194203 CTATTCAAGGTTGGGTGAGGTGG + Intronic
969381378 4:6800843-6800865 CTCTGAAAGGTTATGTGAGGGGG + Intronic
969684336 4:8661885-8661907 CTCTGAAAGTTTAAGTGAGGTGG - Intergenic
971696611 4:29912470-29912492 CTGTCAAAGGTTTAATGATGAGG + Intergenic
977907988 4:102500083-102500105 CACTTAAAGGTCGACTGTTGGGG + Intergenic
978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG + Intergenic
979587202 4:122434363-122434385 CACATTAAGGTTGACTGATGGGG - Intergenic
982393112 4:154886984-154887006 ATATTAAAGTTTGGGTGATGGGG + Intergenic
984084316 4:175289640-175289662 CTAACAAAGGTTGAGTCATGAGG - Intergenic
984467340 4:180117182-180117204 CTCTTAAATGTGTAGTGATAAGG + Intergenic
988997340 5:36727064-36727086 CTCTTGAAGGATCAGTAATGTGG + Intergenic
989205811 5:38807954-38807976 CTCTAAAAGTTTGAATGATACGG - Intergenic
989335472 5:40311391-40311413 CACTCAAAGGAAGAGTGATGAGG - Intergenic
991994635 5:72375194-72375216 CTCTGAAAGTTTGTCTGATGTGG - Intergenic
996329146 5:122311223-122311245 CTCTTAATTGTTGAGGGATTGGG - Intergenic
996750191 5:126880244-126880266 CCCTGAAAGGTGGAGTGTTGGGG - Intronic
996877369 5:128254063-128254085 CTGTTAAGGGCAGAGTGATGTGG + Intergenic
1003644493 6:7903505-7903527 TACTTACAGGTTAAGTGATGAGG + Intronic
1006360498 6:33584532-33584554 CTCTCAAAAGTAGGGTGATGAGG - Intergenic
1007448620 6:41926191-41926213 CACTTAAAGGATGAGTGGTGAGG - Intronic
1009691500 6:67039256-67039278 ATCTTAAGGGTGTAGTGATGTGG - Intergenic
1013284438 6:108668742-108668764 TTCTACAAGATTGAGTGATGTGG - Intronic
1017417780 6:154239987-154240009 TTCTTCAAGGTTGGGTGCTGTGG - Intronic
1017735201 6:157356471-157356493 CTCTTTAAGGTTGAGAACTGAGG - Intergenic
1018692065 6:166354508-166354530 CTCAAAAAGGCTGAGGGATGGGG - Intergenic
1019135893 6:169907554-169907576 CTCTTGGAGGTTGAGGGATGTGG + Intergenic
1020040672 7:4998504-4998526 CTCTGAGAGGTTAAGTGATGAGG + Intronic
1023184352 7:37517438-37517460 CTCTTCAAAATTGTGTGATGTGG - Intergenic
1027607384 7:80317369-80317391 CTCTTAAATGTTGATAAATGTGG - Intergenic
1027898398 7:84075868-84075890 ACCTTAAAGGTTAAGTAATGGGG - Intronic
1027900021 7:84100990-84101012 CTCCTACAGGATGAGAGATGGGG - Intronic
1028041254 7:86057982-86058004 CTGTATCAGGTTGAGTGATGAGG - Intergenic
1028983068 7:96988865-96988887 CTCCTAAAGGGTGAGTGTTTCGG + Intergenic
1030791619 7:113736921-113736943 CTCTTAAAGGTAGAGAAAAGAGG - Intergenic
1031398609 7:121303955-121303977 CTCTTAAAACTTCAGTTATGAGG - Intergenic
1035185777 7:157125108-157125130 CTCTTGAAGGTTGAGGATTGTGG - Intergenic
1035387453 7:158483823-158483845 CTTTAAAAGGCTGAGTTATGTGG - Intronic
1036695950 8:10975272-10975294 CTCCTGAAGGCTGGGTGATGGGG - Intronic
1044316008 8:90750935-90750957 CTATATCAGGTTGAGTGATGAGG - Intronic
1046058761 8:109110779-109110801 GGCTTAAAAGTTGAATGATGGGG - Intronic
1047253684 8:123199890-123199912 CTGTTAAGGGTTGAGGGCTGGGG - Intronic
1047700717 8:127446974-127446996 CTCTTAAAGGCTGGGTGCGGTGG - Intergenic
1051769316 9:20558986-20559008 CACTAAAAGGCTGAATGATGAGG + Intronic
1053791318 9:41688247-41688269 CACTGAAGGGTTTAGTGATGTGG + Intergenic
1054179666 9:61899941-61899963 CACTGAAGGGTTTAGTGATGTGG + Intergenic
1054473623 9:65557645-65557667 CACTGAAGGGTTTAGTGATGTGG - Intergenic
1054657872 9:67680880-67680902 CACTGAAGGGTTTAGTGATGTGG - Intergenic
1055164875 9:73178928-73178950 CTTTCAAAGGGTGAGTAATGAGG + Intergenic
1062494225 9:136824088-136824110 CACTAAAAGGTTCAGTGAGGTGG + Intronic
1186264139 X:7813377-7813399 CTGTTAAAGGTGGTGTAATGTGG + Intergenic
1188972868 X:36638654-36638676 TGCTTAAAGGTTGGGTGGTGGGG + Intergenic
1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG + Exonic
1190165623 X:48071052-48071074 GTCTGTAAGGGTGAGTGATGGGG - Intronic
1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG + Intergenic
1194674344 X:96775729-96775751 CTCTTAATGGCTAAGTGATTGGG + Intronic
1196176226 X:112641863-112641885 CTCTGAAAGTTAGACTGATGTGG - Intronic
1196663124 X:118289339-118289361 CTCTGAAAGGTTGCCTCATGGGG + Intergenic
1199165914 X:144674968-144674990 CTCTTAAACATTGAGTTACGAGG - Intergenic
1199255626 X:145715726-145715748 CCTTTAAAGGTTGACTGATGTGG - Intergenic
1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG + Exonic