ID: 1075374560

View in Genome Browser
Species Human (GRCh38)
Location 10:121968076-121968098
Sequence CCCTGTGGGCACGTATACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075374560_1075374568 9 Left 1075374560 10:121968076-121968098 CCTGGGTATACGTGCCCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1075374568 10:121968108-121968130 CAATACCTGGAGACATTTGTGGG No data
1075374560_1075374566 -4 Left 1075374560 10:121968076-121968098 CCTGGGTATACGTGCCCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1075374566 10:121968095-121968117 AGGGGTCTTCTGGCAATACCTGG No data
1075374560_1075374567 8 Left 1075374560 10:121968076-121968098 CCTGGGTATACGTGCCCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1075374567 10:121968107-121968129 GCAATACCTGGAGACATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075374560 Original CRISPR CCCTGTGGGCACGTATACCC AGG (reversed) Intronic
904315333 1:29656392-29656414 CCCTGTGGGAAAATATTCCCTGG + Intergenic
906754155 1:48292881-48292903 CTCTGTGGGCACCCAAACCCTGG - Intergenic
907636472 1:56139966-56139988 CCCTGTTGACACGTGTGCCCTGG - Intergenic
908011304 1:59780123-59780145 CCTTGTGGTCACGTATCCCCTGG - Intergenic
911310746 1:96289323-96289345 CCCTGTGAGCAGGTATGGCCAGG + Intergenic
1063740098 10:8807941-8807963 ACCTCTGGGCATGTAAACCCTGG + Intergenic
1065445574 10:25795081-25795103 CCCTGTGGGCATGTTTTCCTTGG - Intergenic
1071483888 10:86085276-86085298 CCCTGTGGGCAGGCAGACACTGG - Intronic
1071854507 10:89609870-89609892 CCCTGGGGTAACGTATACCCTGG - Intronic
1072612697 10:97029378-97029400 CCTGGTGGGCAGGCATACCCAGG - Intronic
1072732241 10:97854077-97854099 CCACGTGGGAATGTATACCCAGG - Intronic
1075374560 10:121968076-121968098 CCCTGTGGGCACGTATACCCAGG - Intronic
1076399206 10:130168567-130168589 GCCTGTGGTCACGGCTACCCGGG - Intronic
1082910287 11:58365481-58365503 TCATGTGGGCACATATACACAGG - Intergenic
1084746254 11:71171825-71171847 CCCTGTGGCCTCGTTTAACCAGG + Intronic
1084854863 11:71976712-71976734 CCCTGTTGGCATATATTCCCTGG + Intronic
1090469462 11:126967388-126967410 CCCTGTGGGAAGTTATTCCCTGG - Intronic
1094288670 12:28821323-28821345 CCCTGTGGTCTCAGATACCCAGG + Intergenic
1097185082 12:57192441-57192463 CACTGAGGGCACGTGCACCCAGG - Intronic
1103013520 12:117476358-117476380 CCCTGTAGACAGGTACACCCTGG + Intronic
1114083434 14:19220251-19220273 CCCTCCGGGCACCTCTACCCAGG - Intergenic
1144684497 17:17216914-17216936 CGCAGTGGGCACGGAGACCCGGG - Intronic
1145877032 17:28326811-28326833 CCCTGTAGGCATCTCTACCCTGG - Exonic
1153913780 18:9727181-9727203 CCATGTGGGCCCGTATGCCCTGG + Intronic
1154500118 18:14991914-14991936 CCCTCCGGGCACCTCTACCCAGG - Intergenic
1162879429 19:13647237-13647259 CTCTGGGGGCACCTATAGCCAGG - Intergenic
1168241873 19:55092661-55092683 CCCTGTGGGCAGGTAGACGGGGG + Exonic
933615468 2:84478641-84478663 CCCTGTGTGCAAGAGTACCCCGG + Intergenic
937201440 2:120206739-120206761 CCCTGTGGGTATTTAAACCCAGG + Intergenic
1171371363 20:24664425-24664447 CCCTGTGGTCAGGACTACCCTGG - Intronic
1172133739 20:32673453-32673475 CCCCGTGGGCACAGAGACCCAGG + Intergenic
1178824167 21:36001664-36001686 CCCTTTGTGCATGTACACCCTGG + Intronic
1180050157 21:45327413-45327435 CACTGGGGGCACGGAGACCCAGG + Intergenic
1180294541 22:10873016-10873038 CCCTCCGGGCACCTCTACCCAGG + Intergenic
1180497347 22:15902430-15902452 CCCTCCGGGCACCTCTACCCAGG + Intergenic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184444858 22:44541078-44541100 CCATGTGGGAACTTAGACCCCGG - Intergenic
959951614 3:112185561-112185583 CACTGTGGGCACCTGTGCCCGGG + Intronic
961432930 3:126896008-126896030 CCCTGGGGGCACAGAGACCCCGG - Intronic
965950078 3:174298326-174298348 CCCTCTGGGAACTTATACTCTGG - Intergenic
999481979 5:151956913-151956935 CCCTGTGGGTAAGTCTACCTGGG + Intergenic
1005717098 6:28559882-28559904 TCCTGTGAGCACTTCTACCCAGG - Intergenic
1007637061 6:43305955-43305977 CCCTGTGGTTAAGCATACCCTGG - Intronic
1032476177 7:132212900-132212922 TCCTCTGGGCACGTAAACCCAGG - Intronic
1032803562 7:135335447-135335469 CCCTGTGGGCCCGTCCACTCAGG - Intergenic
1034267709 7:149789278-149789300 CCCTGGGGGCACGGATAGCTCGG - Intergenic
1040480273 8:47819118-47819140 CCTTGTGGGCAGGTATCCTCTGG + Intronic
1041388928 8:57331949-57331971 CACTGTAGGCAGGTGTACCCAGG - Intergenic
1048512970 8:135079012-135079034 CCCTGCAGGCACTTATAACCTGG + Intergenic
1049637435 8:143696635-143696657 CCCTGTTGGCACCTCTACCTCGG - Intronic
1052535609 9:29742799-29742821 ACCTGCAAGCACGTATACCCTGG - Intergenic
1057967639 9:99519521-99519543 TCCCATGGTCACGTATACCCTGG - Intergenic
1060157499 9:121329903-121329925 CCCTGTGAGAACGTAAGCCCTGG - Intronic
1186008373 X:5100769-5100791 ACTTTTGGGCAGGTATACCCAGG - Intergenic
1190056061 X:47181656-47181678 CCCTGTGGGTATGTATCCCGGGG + Intronic
1191685480 X:63885198-63885220 CCCTGTGGGTGAGTTTACCCAGG - Intergenic
1200645786 Y:5781777-5781799 CCCAGTGGGGCTGTATACCCTGG - Intergenic